CENTER FOR CELL & GENE THERAPY VECTOR DEVELOPMENT LABORATORY, 10 TH FLOOR, ALKEK BUILDING ONE BAYLOR PLAZA, HOUSTON, TEXAS 77030

Transcription

1 1. Purpose 1.1. The purpose of this protocol is to detect host cell DNA contamination in purified viral vector preparations This procedure is routinely performed in the Vector Development Laboratory (L) following Good Laboratory Practices (GLP). 2. Abbreviations and Definitions 2.1. SOP Standard Operating Procedure 2.2. L Vector Development Laboratory 2.3. GLP Good Laboratory Practice 2.4. BSC Biological Safety Cabinet 2.5. Q-PCR Quantitative-Polymerase Chain Reaction 2.6. ABI Applied Biosystems Inc. 3. Equipment, Materials, and Reagents NOTE: All materials in contact with cells must be sterile, pyrogen-free and used according to the manufacturer s directions unless stated otherwise. Equivalent materials and equipment may be used but all changes must be recorded Equipment BSC Vortex Heat Block set at 56 C HT Fast Real-Time PCR System Microcentrifuge Computer SDS2.1 Software 3.2. Materials Well Optical Reaction Plate ABI Optical Caps ABI Sterile pipet tips VWR ml tubes Axygen 3.3. Reagents B-actin - 6FAM-AGGCGGACTATGACTTAGTTGCG TACACCCT -MGBNFQ ABI B-actin (forward): CGTCCACCGCAAATGCTT Operon Page 1 of 5

2 B-actin (reverse): TGCGCAAGTTAGGTTTTGTCA Operon TaqMan Universal PCR Master Mix ABI Sterile Water Baxter 3.4. Starting Materials Begin with 30 μl of purified vector Test Sample Identification The bar code on the plasmid will be scanned and compared to the computer database to ensure the correct sample is being processed One copy of the barcode will be printed and applied to a copy of this SOP for the final record. 4. Procedure SDS 2.1 Software 4.1. Open Detect Cellular DNA Template in the SDS2.1 Program Assign each sample a well in the 96-well optical plate Select a detector, sample type (Standard, Unknown or No Template Control) 4.4. Enter the name of each sample and concentration of standards Transfer data to computer connected to the 7900HT Fast Real-Time PCR System. Prepare standard curve using plasmid DNA (plasmid) 4.6. Dilute plasmid in H 2 O to obtain 1x10 9 plasmid copies/10 μl Make 9, 10-fold serial dilutions of the plasmid to obtain the following dilutions for the standard curve: 1x10 6 copies/10 μl 1x10 5 copies/10 μl 1x10 4 copies/10 μl 1x10 3 copies/10 μl 100 copies/10 μl 10 copies/10 μl 1 copies/10 μl 4.8. Prepare PCR cocktail 4.9. Dilute the primers from the 10 μm stock to 2.0 μm working concentration Dilute the probe from the 100μM stock to 2.5 μm working concentration. Note: The probe is light-sensitive In a 1.7 ml tube, prepare the Q-PCR cocktail as described in the table below Prepare cocktail for 35 reactions. Page 2 of 5

3 X26 TaqMan Universal PCR Master Mix 25 μl 650 μl TaqMan Probe (2.5 μm) 5 μl 130 μl Primer 1 (2.0 μm) 5 μl 130 μl Primer 2 (2.0 μm) 5 μl 130 μl Total 40 μl 1040 μl Note: The primer/probe set was designed to anneal to a discrete sequence in the E1 gene The 35 reactions are distributed as follows: Standard curve (1x10 9 plasmid copies 1 plasmid copy) X2 Positive Control (1x10 3 plasmid copies) X3 Sample X3 No template control X4 Note: The reaction volume prepared includes extra to account for pipeting errors Aliquot 40 μl of the cocktail into each well of the 96-Well Optical Reaction Plate Aliquot 10 μl of standard or sample in their respective wells Cover samples with Optical Caps Tap out all air bubbles that formed in the bottom of the wells Transfer reaction plate to 7900HT Fast Real-Time PCR System Run program Step UNG Incubation AmpliTaq Gold PCR Activation Hold Hold Cycle (40 cycles) Time 2 min 10 min Denature Anneal/Extend Temp 50 C 95 C 95 C 60 C Volume 50 μl Analyze data using the SDS 2.1 Software. 5. Data Collection and Management 5.1. All data will be saved to a file with the name of the file being the date the assay was run (year/month/day) and the vector name-hostcell. (example: Ad5eGFP-hostcell) This data will be saved on the L server Hardcopies of the raw data will be printed and stored in the L permanent records. Page 3 of 5

4 5.4. A final report will be produced from the raw data and inserted into the laboratory notebook and a copy will be stored in the L permanent files Deviations of the protocol will be recorded in the laboratory notebook and on the Lab Meeting Sheet. 6. Review and Revisions Written by: Director, L Director, QA/QC Director, Vector Production Date Issued: 1/30/2006 Replaces L Annual Review: 2011 Date Issued: 6/10/2011 Replaces L Date: 2013 Page 4 of 5

5 Date: Page 5 of 5