Aspergillus fumigatus CalA binds to integrin α 5 β 1 and mediates host cell invasion
|
|
- Barbra Underwood
- 5 years ago
- Views:
Transcription
1 In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION ARTICLE NUMBER: DOI: /NMICROBIOL Aspergillus fumigatus CalA binds to integrin α 5 β 1 and mediates host cell invasion Hong Liu, Mark J. Lee, Norma V. Solis, Quynh T. Phan, Marc Swidergall, Benjamin Ralph, Ashraf S. Ibrahim, Donald C. Sheppard, and Scott G. Filler This file includes: Supplementary Tables S1-S2 Supplementary Figures S1-S14 NATURE MICROBIOLOGY Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
2 Supplementary Table 1 Strains of Aspergillus fumigatus and Saccharomyces cerevisiae used in this study. Strain Relevant Genotype Reference A. fumigauts Af293 Wild-type clinical isolate ATCC CEA10 Wild-type clinical isolate 1 ATCC46645 Wild-type clinical isolate 2 CalA-RFP CalA-RFP::ble* This study ΔcalA ΔcalA::hph* This study ΔcalA+calA ΔcalA::hph; pcala* This study Af293-GFP GFP* This study ΔcalA-GFP ΔcalA::hph; GFP* This study ΔcalA+calA-GFP ΔcalA::hph; pcala; GFP* This study S. cerevisiae S150-2B MATa leu -,112 ura -, trp -,his3-3 CalA-S pcala-rfp This study pesc-s pesc This study CalAAls1 pcala-rfp; pals1 This study pescals1 pesc; pals1 This study * Strains are in Af293 background, strains are in S150-2B background. 1 Fedorova, N. D. et al. Genomic islands in the pathogenic filamentous fungus Aspergillus fumigatus. PLoS Genet 4, e (2008). 2 Langfelder, K. et al. Identification of a polyketide synthase gene (pksp) of Aspergillus fumigatus involved in conidial pigment biosynthesis and virulence. Med Microbiol Immunol 187, (1998). 3 Fu, Y. et al. Expression of the Candida albicans gene ALS1 in Saccharomyces cerevisiae induces adherence to endothelial and epithelial cells. Infect Immun 66, (1998).
3 Supplementary Table 2 PCR primers used in this study. Primer name CalA-P1 CalA-P2 CalA-P3 CalA-P4 HY YG CalA-RT-F CalA-RT-R CalA-Com-F CalA-Com-R CalA-RFP-F CalA-RFP-R scala-rfp-f scala-rfp-r GAPDH-F GAPDH-R ASPF1 ADR1 Primer sequence (5'-3') CACCAGTACGTCGGTCAATCTTG ACTGAGGATGTAGAGACTG CACCTCAACTCTTGCTTGATGC ACTGCTTCTGCATCATCAG GGATGCCTCCGCTCGAAGTA CGTTGCAAGACCTGCCTGAA TCACCAAGGCCTTCTTCG AGCCGTGGGTGGCATGGTC ATTGCGGCCGCTCCATTCGAGGCAAGGATC TAAGCGGCCGCAGACTCTGGACTGGAGAC TAAGAGCTCCCATTCGAGGCAAGGATC TATGATATCGTTGCCAATGTTCACCAC TAGACTAGTATGATGTTCACCAAGGCC ATTGAGCTCTTAGGCGCCGGTGGAGTG CCTCGTCCCGTAGACAAAATG TCTCCACTTTGCCACTGCAA GCACGTGAAATTGTTGAAAGG CAGGCTGGCCGCATTG
4 Supplementary Figure 1 CalA is expressed on the cell surface of A. fumigatus a, Confocal microscopic images of A. fumigatus Af293 transformed with an RFP plasmid and grown on the indicated host cells. Results are representative of 3 independent experiments. Scale bar, 10 μm. b, Confocal microscopic images of the indicated strains stained with an anti-cala antibody. Scale bar, 5 μm. c, Flow cytometric analysis of the binding of the anti-cala antibody to germlings of the indicated strains. Results are representative of 3 independent experiments.
5 Supplementary Figure 2 CalA is Expressed on the surface of swollen conidia Confocal microscopic images of wild-type A. fumigatus Af293 expressing CalA-RFP after a 4 h incubation with A549 epithelial cells (top) or laminin coated coverslips (bottom), demonstrating that CalA is expressed on the cell surface of swollen conidia. Results are representative of 3 independent experiments. Scale bar, 5 μm.
6 Supplementary Figure 3 The ΔcalA mutant has wild-type adherence a-d, Adherence of swollen conidia (a, b) and germlings (c, d) of the indicted A. fumigatus strains to 6-well tissue culture plates containing A549 epithelial cells (a, c) or coated with laminin (b, d). Data are mean ± SD of 3 experiments each performed in triplicate. e, Adherence swollen conidia to fluid-phase laminin. The indicated trains of A. fumigatus were incubated with AlexaFluor 488- labelled laminin, washed and then fixed. The fluorescence intensity was quantified by flow cytometry. Results are representative of 2 independent experiments.
7 Supplementary Figure 4 Deletion of cala has no effect on galactosaminogalactan production a, Amount of galactosaminogalactan released into the medium. b, Percentage of hexosamine released into the medium. c, Percentage of hexose released into the medium. Results are mean ± SD of 3 independent experiments.
8 Supplementary Figure 5 Effects of different substrates on the morphology of A. fumigatus hyphae Scanning electron micrographs of the indicated strains of A. fumigatus that had been germinated for 18 h in RPMI 1640 broth and then incubated for 6 h either on coverslips coated with poly-dlysine (positively charged) or on uncoated glass coverslips (negatively charged). Scale bar, 20 µm.
9 Supplementary Figure 6 Susceptibility of the ΔcalA mutant to different cell wall and cell membrane stressors Images of serial 10-fold dilutions of the indicated strains that were plated onto Sabauroud (Sab) agar containing 200 μg/ml Congo red, 300 μg/ml calcofluor white (CFW), 40 μg/ml caspofungin, 0.01% SDS, 3 mm H 2 O 2 or 2 mg/ml protamine sulfate and incubated at 37 C for 2 days. Results are representative of 3 independent experiments.
10 Supplementary Figure 7 The ΔcalA mutant has wild-type susceptibility to killing by macrophage-like and neutrophillike HL-60 cells Germlings of the indicated strains were incubated with HL-60 cells that had been differentiated into macrophage-like (a) or neutrophil-like (b) cells. After 2.5 h, the percentage of surviving organisms was determined by quantitative culture. The results are the mean ± SD of 3 experiments, each performed in triplicate.
11 Supplementary Figure 8 sirna knockdown of integrin α3 has no effect on endocytosis A549 epithelial cells (a) and vascular endothelial cells (b) were transfected with either control (Cntrl) or integrin (Int) α3 sirna and then infected with A. fumigatus Af293, after which the number of internalized organisms was determined by a differential fluorescent assay. Results are mean ± SD of 3 independent experiments, each performed in triplicate. HPF, high-powered field. c, d, representative immunoblots of epithelial cell (c) and endothelial cell (d) lysates showing the knockdown of integrin α3. Results are representative of 3 independent experiments.
12 Supplementary Figure 9 Effects of sirna knockdown of both integrin α5 and β1 on endocytosis A549 epithelial cells (a) and vascular endothelial cells (b) were transfected with either control sirna or integrin α5 and β1 sirnas, and then infected with A. fumigatus Af293, after which the number of internalized organisms was determined by a differential fluorescent assay. Results are mean ± SD of 3 independent experiments, each performed in triplicate. *P < compared to control (two-tailed Student s t-test assuming unequal variances). HPF, high-powered field. c, d, representative immunoblots of epithelial cell (c) and endothelial cell (d) lysates showing the knockdown of integrins α5 and β1. Results are representative of 3 independent experiments.
13 Supplementary Figure 10 Integrin α5β1 binds to clinical isolates of A. fumigatus and is required for maximal host cell invasion a, Immunoblots of A549 epithelial cell membrane proteins that had been eluted from the indicated clinical isolates of A. fumigatus. Blots were probed with an antibody against integrin β1 (top) and integrin α5 (bottom). Results are representative of 3 independent experiments. b, Effects of an anti-integrin β1 antibody on the endocytosis of the indicated clinical isolates of A. fumigatus by A549 epithelial cells. Results are mean ± SD of 3 experiments, each performed in triplicate. *P < 0.01 compared to cells incubated with the control IgG (two-tailed Student s t-test assuming unequal variances). HPF, high-powered field.
14 Supplementary Figure 11 Inflammatory response induced by CalA Representative images of thin sections of the lungs of corticosteroid-treated mice after 5 d of infection with the indicated strains. The sections were stained with periodic acid-schiff (PAS; top panels) and hematoxylin and eosin (H&E; bottom panels). Results are representative of 6 images of the lungs of 2 mice per strain of A. fumigatus. Arrows indicate the A. fumigatus hyphae. Scale bar, 50 μm.
15 Supplementary Figure 12 The ΔcalA mutant induces a wild-type inflammatory response Endothelial cells were infected for 16 h with the indicated A. fumigatus strains, after which the medium above the cells was collected and analyzed for cytokine content. Results are mean ± SD of 3 independent experiments, each performed in triplicate.
16 Supplementary Figure 13 Full size blots shown in Figures 3 and 4.
17 Supplementary Figure 14 Full size blots shown in Supplementary Figures 8-10.