The P53 negative human lung carcinoma cell line H1299, the T-cell lymphoma EL4 and the

Transcription

1 Materials and Methods Cell culture and transient transfection The P53 negative human lung carcinoma cell line H1299, the T-cell lymphoma EL4 and the CD8 + B3Z cells was cultured in RPMI 1640 supplemented with 10 % FCS and Streptomycin and Penicillin. H1299 cells were transfected with indicated amount of cdnas using Fugene (Roche) and EL4 cells were transfected using nucleofection (Amaxa). Plasmid Construction All plasmids were generated using standard procedures. Restriction enzymes, T4 DNA ligase and calf intestinal alkaline phosphatase were obtained form New England Biolabs. Purified synthetic oligonucleotides were obtained either from MWG biotech or Thermo Hybaid. Routine plasmid maintenance was carried out in DH5. Full length B95-8 EBNA1 was obtained as a 2.5 Kb genomic fragment (viral coordinates ) in puc1318 (Kay and McPherson, 1987). A previously described EBNA1 GAr deletion mutant (Blake et al., 1997) was obtained as a 1.7 Kb fragment equivalent to viral co-ordinates 107, ,280 ( , residues , deleted) in puc1813. Both EBNA1 plasmids were obtained from Neil Blake and Alan Rickinson (University of Birmingham, UK). Full-length EBNA1 and GAr domain deleted EBNA1 expression constructs (EBNA1wt and EB GA respectively) with identical 5 and 3 UTRs were constructed in pcdna3 (Invitrogen), providing CMV and T7 promoters. Full-length EBNA1 was first subcloned into the HindIII site of pcdna3. This plasmid was used to create EB GA by replacing the 2340 bp BspEI BamHI fragment with the equivalent 1423 bp fragment from the GAr domain deleted construct. EBNA1wt was constructed from the full

2 length HindIII/ pcdna3 by replacing the 1242 ApaI fragment with the equivalent 1024 bp fragment from EB GA. Thus both EBNA1wt and EB GA carry 21 bp of the viral 5 UTR (harbouring the native ATG environment) and 399 bp of the viral 3 UTR. A cloning cassette containing the GAr domain encoding DNA was generated from EBNA1wt. First, the 236 bp HindIII-BspEI fragment encoding the 5 region of EBNA1 was replaced with a synthetic 14 bp fragment, generated by annealing oligos 5 LINK-1 (5 AGC TTC TCG AGG ATA TCG T3 ) and 5 LINK-2 (5 CCG GAC GAT ATC CTC GAG A3 ), inserting new XhoI and EcoRV sites between the HindIII and BspEI sites. Second, the 677 bp BstX1 fragment encoding the 3 region of EBNA1 was replaced with a synthetic 19 bp fragment, generated by annealing oligos 3 LINK- 1 (5 GTG ATA TCC TCG AGG AAT TCC ACA3 ) and 3 LINK-2 (5 GAA TTC CTC GAG GAT ATC ACC TTC3 ), inserting new EcoRV, XhoI and EcoR1. Ova-GAN was constructed by excising the GAr cassette with HindIII and EcoRI and inserting it 5 of a chicken Ovalbumin sequence lacking the first 50 amino acids (Ova). Ova-GAC was made by inserting Ova in the 5 end of the GAr cassette using the EcoRV site. EB-GAC was constructed by replacing the Ova fragment from Ova-GAC with the EB GA sequence. EB-GAC3 was constructed by excising the GAr encoding cassette with Xho1 and inserting this into EB GA within the plasmid polylinker and 3 of the encoding sequence. The Ova-Cpep construct was made by replacing the full-length GAr sequence in the Ova-GAC with an oligonucleotide sequences corresponding to 20 amino acids of the GAr and the Ova-Npep was made in a similar way by replacing the GAr from the Ova-GAN with a similar oligonucleotide sequence. The sequence of all constructs was confirmed by DNA sequencing.

3 In vitro Transcription Capped messenger RNA was synthesised by in vitro transcription using T7 RNA polymerase (mmessage mmachine high yield capped RNA transcription kit, Ambion UK). Reactions were carried out at 37 o C for two hours except transcription from plasmids containing the fulllength GAr domain, which was carried out at room temperature for two hours. Following digestion of template DNA, RNA was purified using silica membrane spin columns (RNeasy Mini Kit, Qiagen UK), ethanol precipitated and quantified by absorption at 260 nm. Size and homogeneity were confirmed by electrophoresis in formaldehyde-agarose gels (Sambrook et al., 1989). In vitro Translation Nuclease treated reticulocyte lystates and the coupled transcription translation systems (TNT Quick kit) were obtained form Promega. Unless stated otherwise 10 l reactions, containing 70% lysate and 1.5 l L-[ 35 S]methionine (15 mci/ml, > 1000 Ci/ mol; Amersham Pharmacia Biotech, UK) were carried out at 30 o C for 90 minutes. All reactions were supplemented with 8 U human placental ribonuclease inhibitor (Promega UK). For coupled transcription translation supercoiled plasmid DNA was added to 20 g/ ml. For two step translations, RNA message was added at the stated concentrations. Unless analysed by TCA precipitation, reactions were terminated by transfer to ice and addition of 4 volumes of 2 X SDS loading buffer (50mM Tris- HCl (ph 6.8), 2 % SDS, 0.1 % bromophenol blue, 10 % glycerol, 0.7 M mercaptoethanol. 10 l aliquots were analysed by SDS-PAGE on 4-12% NuPAGE Bis-Tris gels (Novex). Dried gels were exposed overnight to phosphor screens (Kodak) which were read using a Biorad FX imager. For TCA precipitation 5 l reaction aliquots were spotted onto 2 cm squares of 2MM

4 filter paper (Whatman) then immediately washed three times in boiling 5% TCA/ 1mM methionine, followed by once in ethanol. Dried squares were exposed overnight to a phosphor screen. Antibody Purification Puriication of anti-gar specific antibodies has been described elsewhere (17). Outdated human plasma were obtained from the East of Scotland Blood Transfusion Service (Ninewells Hospital, Dundee) and screened by ELISA for reactivity with immobilised peptide (biotin- AGAGGGAGGAGAGGGAGGAG). Three positive sera were pooled for purification of anti-ga antibody. A C-terminal cysteine residue was used to couple peptide (AGAGGGAGGAGAGGGAGGAGC) to iodoacetyl agarose (Sulfolink Coupling Gel, Pierce) at 1mg of peptide per ml of resin. Coupled beads were transferred to a 2.5 ml column, washed with PBS, loaded overnight with filtered serum (~ 700 ml). The column was washed with 20 volumes of PBS/ 0.2% Tween 20 then 5 volumes of PBS and bound protein then eluted with 0.1 M glycine-hcl (ph 3.0). Neutralised peak fractions were dialysed into 50 mm MES (ph 6.0), 20 mm NaCl then loaded onto a MonoS column and eluted with a linear NaCl gradient to 1 M. Peak IgG fractions were pooled, dialysed into PBS and stored at 4 o C. Control human IgG was purified from 5 mls of EBV negative serum using protein G sepharose (Amersham Pharmacia Biotech, UK) followed by MonoS chromatography as above. Rabbit antibodies were raised by immunising New Zealand white rabbits. With peptide (AGAGGGAGGAGAGGGAGGAG) coupled to KLH by formaldehyde crosslinking. Sera was tested for GAr polyclonal antibodies and purified over protein G sepaharose and dialysed in PBS. A mab directed toward the C- terminus of EBNA1 was obtained from ViroStat, Portland, USA.

5 Metabolic cell labelling and immunoprecipitation H1299 cells transfected with indicated constructs were cultured for 36 hours before treated with 20 M MG132 for one hour in methionine free medium mci/ml of [ 35 S]methionine (Amersham) was added and the cells were harvested at indicated time points by washing twice in ice cold PBS and scraped off the dish using a rubber policeman. Cells were lysed in PBS containing 1 % NP40 and protease inhibitor cocktail (Roche) at 4 o C. Cell lysates were cf. for 15 minutes at rpm and pre-cleared by addition of protein G sepharose. An equal amount of total protein was incubated with indicated mab for 2 hours at 4 o C before the immune complexes were recovered using protein G sepharose. The proteins were separated on SDS-PAGE and the amount of labelled protein was visualised by autoradiography and the relative amount of protein synthesis was determined using phosphoimager. Northern Blotting Total RNA was isolated using Qiagen RNeasy. After separation on agarose gels, the RNA was transferred to nylon filters. DNA probes were labelled with [ 32 P]ATP using Pharmacia/Amersham ReadyPrime. The probe used for EBNA1wt and EB GA correspond to 1050 nt. of the C-terminus and the 3 UTR of EBNA1 and was generated by Apa I digestion of the EB GA construct (see above).the pre-hybridisation and hybridisation was done in ULTRAhyb buffer (Ambion) according to the manufacturer s protocol.

6 T-cell assays EL4-K b restricted cells (2x10 4 ) expressing the indicated ovalbumin constructs for 48h were washed, fixed in 0.05% glutaraldehyde and cultured with B3Z T cell hybridoma 24 (5x10 4 ) for 20h. The cells were then harvested and washed 2 x PBS prior to lysis in 0.2% TritonX- 100, 0.5M K 2 HPO 4 for 10 min on ice. The lysates were centrifuged for 10 min and 25 l of supernatant was tested for -Galactosidase activity using the Luminescence assay (Clontech) on a microbeta liquid scintillation counter (LKB Wallace).