A Systematic Approach to Optimize Real-Time Quantitative RT-qPCR Experiments with the Agilent 2200 TapeStation System

Transcription

1 Systematic pproach to Optimize Real-Time Quantitative RT-qPCR Experiments with the gilent TapeStation System pplication Note Nucleic cid nalysis uthor runkumar Padmanaban gilent Technologies, Inc. angalore, India bstract This pplication Note describes and demonstrates the effi ciency of the gilent TapeStation system and the RN ScreenTape assay in RT-qPCR workfl ows for assessing the integrity of the initial total RN template. This template is crucial for the successful amplifi cation of the target genes. Moreover, the D1 ScreenTape assay helps assess the amplifi ed products for sizing and eliminate false positive results. The data presented demonstrate that the TapeStation system is an ideal quality control platform for RT-qPCR workfl ow solutions. The pplication Note further describes the advantages of presenting the qpcr results in accordance with the MIQE guidelines.

2 Introduction RT-qPCR is a complex assay and must be carefully optimized for specificity, sensitivity, and reproducibility. In addition to RN quality, several experimental variables affect the outcome of RT-qPCR assay performance and may lead to false positive results. The Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines were put forth in 9 to develop robust experimental design and evaluate the results. The MIQE guidelines help achieve high quality data by designing and reporting experimental conditions that yield reproducible results. This pplication Note demonstrates the successful application of the TapeStation system to optimize real-time quantitative PCR experiments by recapitulating the experimental outline of a previous study with an gilent 1 ioanalyzer 1. The experimental design for this study followed the guidelines and considerations of the MIQE guidelines. The sample extraction and handling procedure, quality control of total RN, details of commercial kits and reagents, primer sequences, location of the target genes, and qpcr specificity with standard curve and melt analysis are reported at the appropriate sections of the RT-qPCR experimental workflow. The MIQE guidelines direct special attention to the importance of the initial quality control of total RN. Studies have shown that the integrity of the starting material is a crucial factor determining the success of the qpcr assay in amplifying the desired product 3. The RN integrity number equivalent ( ) provides an instant and objective evaluation of total RN degradation for the TapeStation system. is directly comparable in assessing RN integrity to the widely accepted and highly cited RN Integrity Number (RIN) of the gilent 1 ioanalyzer system. Materials and Methods RN purification and analysis HEK93 cells (TCC) were grown in MEM media with 1 % FS, mm L-glutamine, and 1 % strep/penicillin antibiotics, and left to reach 9 % confluency. The cells were then trypsinized and collected as pellets containing cells, and immediately frozen at 8 C until use. Total RN was extracted using the gilent Total RN Isolation Minikit (p/n 18-6) following the manufacturer guidelines. The extracted samples were then analyzed for integrity using the RN ScreenTape and RN 6 Nano assays with TapeStation and 1 ioanalyzer systems respectively following manufacturer guidelines. The samples were also parallel analyzed using NanoDrop spectrophotometer. RN degradation Two vials of high integrity total RN samples containing 1 µg each were incubated at 9 C for different amounts of time ( and 1 minutes) to generate RN with different qualities. Following the degradation, the samples were immediately incubated on ice to stop further degradation. 1 μl amount was taken for analysis using the TapeStation and 1 ioanalyzer systems. The samples were then diluted 1:, and µl were used in subsequent RT reactions. Reverse transcription five-point standard curve was generated using total RN at.1,.1,.1, 1, and 1 ng as final load template amounts. The total RN was reverse transcribed using the gilent ffinityscript QPCR cdn Synthesis Kit (p/n 69) following the manufacturer guidelines in a µl reaction volume ( C for minutes, C for 1 minutes, 9 C for minutes) using an gilent SureCycler 88 Thermal Cycler. Each standard was run in triplicate. µl amount of the cdn was used directly in subsequent qpcr reactions.

3 Real-time quantitative PCR Primers were obtained from Sigma-ldrich as HPLC purified oligonucleotides. Previously published primer sequences were used in this study 1. Primers were designed to target both and 3 splice variants of two genes: hypoxanthine phosphoribosyl transferase-1 (HPRT1) and tyrosine 3-monooxygenase/tryptophan -monooxygenase activation protein, zeta (YWHZ). summary of the primer sequence, gene ID, and amplicon sizes are presented in Table 1. The qpcr reactions were carried out using gilent rilliant III Ultra-Fast SYR Green QPCR Master Mix (688) in a final reaction volume of µl, and a final primer concentration of nm. ROX was used as a passive reference dye at a final concentration of 3 nm. fast thermal cycle of 9 C for 1 minutes, cycles of 9 C for seconds, 6 C for seconds with measurement at 6 C was used. dissociation curve was generated using a thermal profile of 9 C for 3 seconds, 6 C for 3 seconds, and 9 C for 3 seconds with continuous fluorescent measurement along the ramp from 6 C to 9 C. Each standard was run in triplicate, with no reverse transcriptase () and no template control (). ll primers span exon-exon junctions with exception of YWHZ, where the assay has the primers in exons and 3 with a 3.6 kb intron in between. ll qpcr experiments were performed on an gilent Mx3P qpcr system. DN amplicon analysis The amplified products were analyzed using the D1 ScreenTape and DN 1 assays with the TapeStation and 1 ioanalyzer systems for size assessment. Data analysis The qpcr data obtained from the Mx3P system was analyzed using MxPro software and exported to MS Excel for presentation. The quantification cycle (C q ) was calculated based on baseline corrected normalized fluorescence (drn). If not stated otherwise, all samples and standards were run in triplicate. The data is presented as mean ± S.D. T able 1. Details of the primers used in the study. Gene Ensembl gene ID Primers Primer sequence mplicon size (bp) HPRT1 ENSG167 HPRT1 forward -CGTCGTGTTGTGTGTGCCG-3 13 HPRT1 reverse -GCGCGTTCGTCCTGTCC- 3 HPRT1 3 forward - TTCGGGTTTGTCTGTTTGTGTC HPRT1 3 reverse -GCGTGTCTGGCTCCGTG-3 YWHZ ENSG169 YWHZ forward -TTGGCGGGCTGGTTCTGC- 3 1 YWHZ reverse -GCCCTCGCCGTCGG-3 YWHZ 3 forward -CTTCCTTTGCTTGCTCCCCG-3 18 YWHZ 3 reverse -GCTGCGCCTTCGGTGG-3 3

4 Results and Discussion Total RN integrity analysis The extraction procedure, sample processing, and sample integrity are essential information to be documented in qpcr. This ensures that only the highest quality samples are used in the study to obtain meaningful results. Sample integrity was determined using the TapeStation and 1 ioanalyzer systems before the qpcr validation. Total RN was analyzed in replicates of six. The gel images and electropherogram traces showed two intact peaks (8S and 18S) with no degradation products, confirming intact RN (Figures 1 and ). The integrity numbers for the samples were expressed as average and RIN of 1 and 9.7 by the TapeStation and 1 ioanalyzer systems respectively. dditionally, purity analysis on the extracted RN by the NanoDrop spectrophotometer gave an absorbance ratio (6/8) of. for all samples, confirming the absence of contaminants and average yields of µg per pellet. The samples were quantified as ng/µl (6 µg per pellet) and 99. ng/µl (3 µg per pellet) by the TapeStation and 1 ioanalyzer systems respectively. [nt] 1 (L) 1 C1 D1 E1 F1 G1 [nt] Ladder RN 1 RN 1 RN RN RN 3 RN 3 6,, Sample intensity [FU] , Lower 18S 8S RIN RIN RIN RIN RIN RIN L F igure 1. Gel image of total RN analysis carried out by the gilent TapeStation system () and gilent 1 ioanalyzer system () with an average and RIN of 1 and 9.7 respectively., 1, 6, Size [nt] [FU] 1 1, Size [nt] Fi gure. Electropherogram trace of the total RN from the gilent TapeStation system () and gilent 1 ioanalyzer system ().

5 QPCR validation and amplicon analysis The primer specificity was validated following the MIQE guidelines by generating a five-point standard curve with 1 fold dilutions with each standard run in triplicate. The slope of the standard curve (R ), PCR efficiency, C q, and dissociation curve of the controls were evaluated. Primer validation for specificity was carried out using intact total RN with above 9. as template. five-point standard curve with total RN input load ranging from.1 ng to 1 ng was generated for each primer pair. The RN was reverse transcribed into cdn using oligo (dt) primer. The synthesized cdn was used as template for qpcr amplifications. was used to indicate genomic DN (gdn) contamination and was used as negative control. Figure 3 shows an amplification plot and dissociation curve data from YWHZ- and HPRT-3 to illustrate the results. The flat line for shows that there is no gdn carryover from the gilent total RN isolation mini kit, and the shows that the reaction is free from cross contaminations. The dissociation curve of YWHZ- and HPRT1-3 shows a single peak with a T m of 8.3 C and 79 C for all samples across the concentration range. The dissociation curve of the and also shows no presence of amplicons or primer dimers. Fluorescence (drn) pg load 1 pg load 1 pg load 1 ng load 1 ng load Efficiency 9.9 %, Slope 3.61, R =.987 YWHZ-' ssay-amplification plot Fluorescence ( R' (T)) 6,,, 3, 1 pg load 1 pg load 1 pg load 1 ng load 1 ng load YWHZ-' ssay-dissociation curve Cycles Temperature ( C) Fluorescence (drn) C 1 pg load 1 pg load 1 pg load 1 ng load 1 ng load Efficiency 93 %, Slope 3.1, R =.978 HPRT1-3' ssay-amplification plot Cycles Fluorescence ( R' (T)) 6,,, 3, D 1 pg load 1 pg load 1 pg load 1 ng load 1 ng load HPRT1-3' ssay-dissociation curve Temperature ( C) Fig ure 3. mplification plots ( and C) and dissociation curve ( and D) data from YWHZ- and HPRT1-3 primer pairs, respectively.

6 The amplicon sizes were further analyzed using the TapeStation and 1 ioanalyzer systems with the D1 ScreenTape and DN 1 assay. The sizing data from both systems were compared to the theoretical sizes, and are presented in Figure with a positive correlation between both systems with a sizing accuracy of ± %. Typical electropherogram traces presented in Figure show an overlay of YWHZ- products from.1 ng load with average size of 1 bp,, and controls from the TapeStation and 1 ioanalyzer systems respectively. Size (bp) 1 1 mplicon size determination using the gilent TapeStation and gilent 1 ioanalyzer systems Theoretical gilent TapeStation system gilent 1 ioanalyzer system HPRT1-' HPRT1-3' YWHZ-' YWHZ-3' Fig ure. mplicon sizing data from the gilent TapeStation (dark blue) and gilent 1 ioanalyzer (light blue) systems. The theoretical sizes are shown in green. Error bars indicate standard deviation E F 1 pg YWHZ- Sample intensity [FU] , Size (bp) [FU] 8 7 1: 1 pg YWHZ- 11: 1: , Size (bp) Figu re. Electropherogram trace overlay from the YWHZ- assay, showing amplicon data from a 1 pg load (red), (blue), and (green) using the gilent TapeStation system () and gilent 1 ioanalyzer system (). 6

7 Monitoring the impact of RN degradation on qpcr experiments The importance of using only high integrity RN samples for RT-qPCR experiments as recommended by MIQE guidelines was shown by carrying out RT-qPCR amplification using heat-degraded RN as a template. The differentially heat-degraded RN and untreated RN were analyzed using the TapeStation and 1 ioanalyzer systems and designated as high, medium, and low integrity based on. The samples were analyzed using the TapeStation and 1 ioanalyzer systems and designated as high, medium, and low integrity based on. Figure 6 shows gel images from the TapeStation and 1 ioanalyzer systems showing RN with three different levels of degradation and their respective integrity number. n electropherogram trace overlay of the three RN samples from the TapeStation system is presented in Figure 7. qpcr amplifications were carried out using different integrities of total RN. The amplification plots are shown in Figure 7. The C q was determined for all primer pairs. The C q value of the untreated and highly intact RN sample was taken as a reference. The relative C q difference of the treated RN templates was calculated, and is presented in Figure 8. The figure suggests that the end of the HPRT1 gene is more susceptible to degradation compared to the respective 3 end. YWHZ shows a similar level of impact for both and 3 end mrn transcripts. These results clearly show that differential degradation is specific to the respective gene products. [nt] 1 (L) 1 C1 D1 E1 F1 G1 H1 [nt] Ladder T= RN T= RN T= RN T= RN T= RN T= RN T=1 RN T=1 RN T=1 RN T = min T = min T = 1 min 6,,, RIN RIN RIN RIN RIN RIN RIN RIN RIN Figur e 6. Gel image showing the respective RN integrity numbers of untreated and heat degraded RN samples. for the gilent TapeStation (), and RIN for the gilent 1 ioanalyzer () systems Sample intensity [FU] 1 E1 H1 T = mins T = mins T = 1 mins Fluorescence (drn) 6 3 mplification plots HPRT1- RN degradation High intact Medium intact Degraded 1 1, 6, Size [nt] Cycles Figure 7. ) n gilent TapeStation system electropherogram trace overlay for RN samples that are highly intact (green), medium level of degradation (blue), and highly degraded (red). ) mplification plot obtained from the RN of different integrity using HPRT1-3 primers. 7

8 Conclusions The performance of the RN ScreenTape assay using the gilent TapeStation system in assessing the integrity of total RN was compared with the gilent 1 ioanalyzer system and shown to be equal. Following the experimental outline of a previous study, the impact of the RN integrity on the qpcr application was assessed by artificial degradation of total RN samples 1. The results from this study recapitulate and confirm the previous findings that RN integrity impacts the amplification of the target gene, and that directionality is gene dependent. Thus, this study demonstrates that the RN ScreenTape assay can be reliably used in determining the integrity of total RN samples. In addition to RN quality control, the TapeStation system can be used for subsequent sizing analysis of PCR products and provide an ideal system to fit into any qpcr workflow in accordance with the MIQE guidelines. Relative C q difference ' ssay 3' ssay ' ssay 3' ssay Medium integrity Degraded Relative C q difference between high integrity RN versus medium integrity and degraded RN HPRT1 Figure 8. Relative C q for different degradation stages of template RN. References 1. Mueller, S. Optimizing real-time quantitative PCR experiments with the gilent 1 ioanalyzer, gilent Technologies pplication Note, publication number EN, 8. com/library/applications/ en.pdf.. ustin, S.; et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clinical chemistry 9,, pp YWHZ 3. Imbeaud, S.; et al. Towards standardization of RN quality assessment using user-independent classifiers of microcapillary electrophoresis traces. Nucleic cids Research, 33, e6-e6.. Connelly, M., et al. Performance of the gilent RN ScreenTape and the High Sensitivity RN ScreenTape ssay for the gilent TapeStation System, gilent Technologies pplication Note, publication number EN, technicaloverviews/public/991-36en.pdf tapestation This information is subject to change without notice. gilent Technologies, Inc., 1 Published in the US, February 1, EN