SUPPLEMENTARY INFORMATION

Transcription

1 SUPPLEMENTAY INOMATION igure S1 Knockdown of endogenous HI-1α by short-interference NA (sina) reverts EMT and metastatic phenotypes in H1299 cells and in ADU or MC-7 cells undergoing hypoxia. a. Western blot analysis of HI- 1α, epithelial and mesenchymal markers in H1299 cells receiving sina to repress endogenous HI-1α (H1299-HI1α-si). Knockdown of unrelated protein topoisomerase 3α (H1299-top3α-si) and transfection with an empty vector (H1299-cont.) were used as controls. b. Immunofluorescence of E- cadherin (green) and vimentin (red) in H1299-HI1α-si vs. H1299-control cells. c. old change of migration, invasion, and metastasis in H1299- HI1α-si vs. H1299-top3α-si or H1299-control cells. Both orthotopic implantation (open bars) and tail vein injection (closed bars) methods were performed (n=3 for migration or invasion assays; n=6 for orthotopic implantation or tail vein metastasis assays). d. A significant decrease in the tumor size of H1299-HI1α-si vs. H1299-top3α-si or H1299-control cells (n=6). e & g. Western blot analysis of HI-1α, epithelial and mesenchymal markers in ADU or MC-7 cells receiving sina to repress endogenous HI-1α (ADU-HI1α-si or MC7-HI1α-si). Knockdown of unrelated protein topoisomerase 3α (ADU-top3α-si or MC7-top3α-si) and transfection with an empty vector (ADU-cont. or MC7-cont.) were used as controls. f & h. old change of migration and invasion in ADU-HI1α-si vs. ADU-top3α-si or ADU-control cells as well as in MC7-HI1α-si vs. MC7-top3α-si or MC7-control cells (n=3). The asterisk (*) indicated statistical significance (P<0.05) between experimental and control clones. The error bars indicate s.d. The scale bars represent 20 μm in b. 1

2 SUPPLEMENTAY INOMATION igure S2. Immunohistochemistry staining of metastastic tumors generated by ADU-cDNA3 or ADU-HI1α(ΔODD) cells and of E-cadherin and vimentin in different regions of the head and neck cancer samples. a. Both HI-1α(ΔODD) and TWIST were stained in tumors generated from ADU-HI1α(ΔODD) cells, but not from ADU-cDNA3 cells. b. N, normal tissue; T, tumor tissue; I, invasive front of tumor tissue. The black arrows indicate the preserved membraneous E-cadherin expression in N and T samples, whereas the red arrows indicate the keratinization in T samples. The blue arrows indicate the strong vimentin staining in the invasive front of infiltrative tumor cells embedded in the surrounding stroma. The morphologic changes (conversion to a more fibroblastoid morphology, a decrease in keratinization and a loss of cellular cohesiveness) were observed in the invasive front of tumor tissue. The scale bars represent 100 μm in a and 200 μm in b. 2

3 SUPPLEMENTAY INOMATION igure S3 Induction of different EMT regulators by hypoxia or HI-1α overexpression in different cell lines and the critical role of HI-1α in the induction of different EMT regulators. a. Different EMT regulators were activated in ADU and MC-7 cells under hypoxia (n=3 for upper panel). b. Different EMT regulators were activated by constitutive expression of HI- 1α(ΔODD) in ADU cells (ADU- HI1α(ΔODD)) (n=3 for upper panel). c. Different EMT regulators were repressed by sina mediated repression of endogenous HI-1α in H1299 cells (n=3 for upper panel). d. The critical role of HI-1α in the induction of different EMT regulators in ADU and MC-7 cells under hypoxia (n=3 for upper panel). The different bar graph symbols in the inset represented the mna levels of different molecules, which applied to all four upper panels. The asterisk (*) indicated statistical significance (P<0.05) between experimental and control clones. The error bars indicate s.d. 3

4 SUPPLEMENTAY INOMATION igure S4 Transient transfections of different TWIST promoter driven constructs into different cell lines and electrophoretic mobility shift assays (EMSA) using the anti-hi-1β specific antibody, different nuclear extracts, or lower amounts of cold competitors. a & b. Transient transfections of the same set of TWIST promoter driven constructs into SAS, MC-7, or H1299 control vs. H1299-HI1α-si cell lines showed similar results as in igure 4b (n=3 in a & b). The luciferase activity/β-galactosidase of SAS and MC cells co-transfected with pxp2-twist and pcdna3 control vector under normoxic condition was applied as the controls in a, and H1299-control cells transfected with pxp2-twist or pxp2-twist-mut was used as the control in b. The asterisk (*) indicated statistical significance (P<0.05) between experimental and control transfections. The error bars indicate s.d c. EMSA results using the anti-hi-1β specific antibody showed the supershifted band of the same HI-1 binding complex. d. EMSA results using nuclear extracts from two different clones of ADU-HI1α(ΔODD) cells showed similar results as in igure 4c. e. EMSA results using lower amounts of cold competitors showed that the HI-1 binding complex could be gradually competed away as the concentrations of cold competitors increased. 4

5 SUPPLEMENTAY INOMATION igure S5 The critical role of TWIST in the process of EMT as well as migration and invasion in ADU cells under hypoxia, partial rescue of migration and invasion by TWIST overexpression and/or hypoxia in Snail repressed ADU (ADU-Snail-si) cells, and validation of anti-hi-1α, TWIST and Snail antibodies used in immunohistochemistry (IHC) experiments. a. sina mediated repression of TWIST in ADU cells under hypoxia showed the almost complete reversion of EMT markers. b. sina mediated repression of TWIST in ADU cells under hypoxia showed the inhibition of migration and invasion in ADU cells under hypoxia (n=3). c. Western blot analysis of Snail, TWIST and LOX in ADU-Snail-si cells with or without TWIST overexpression under normoxic (N) or hypoxic (H) culture. d. old change of migration and invasion when ADU-Snail-si cells were reconstituted with TWIST under normoxic (N) or hypoxic (H) culture (n=3). The asterisk (*) indicated statistical significance (P<0.05) between experimental and control clones. e. Upper panels: Immunocytochemistry (ICC) analysis of HI-1α in 293T cells under normoxia vs. hypoxia. Peptide blocking reagent without adding antibody (No Ab) was applied as the negative control. Lower panel: Western blot analysis of HI-1α in 293T cells under normoxia vs. hypoxia. f. ICC (upper panels) and Western blot analysis (lower panel) of TWIST in 293T cells transfected with control vector vs. plag-twist. No Ab was applied as the negative control of ICC experiment. g. ICC (upper panels) and Western blot analysis (lower panel) of Snail in 293T cells transfected with control vector vs. pcdna3-snail. No Ab was applied as the negative control of ICC experiment. The error bars indicate s.d. The scale bars represent 50 μm in e, f, g. 5

6 SUPPLEMENTAY INOMATION igure S6 ull length blots/scans of key Western data shown in the regular igures 1a, 1d, 3a, 3b, 3c, 3d, 5a, 6b, and 6d. 6

7 SUPPLEMENTAY INOMATION igure S6 continued 7

8 Table S1. Sequence information for TWIST promoter analysis Luciferase reporter assay ChIP assay DNA origin Proximal TWIST promoter sequence for promoter activity assay Hypoxia response element (HE) Primers used in promoter cloning Procedures of cloning of TWIST promoter into luciferase reporter construct Proximal TWIST promoter containing HE amplified by PC in ChIP assay (198 bp) Primers used for proximal promoter PC Distal TWIST promoter without HE amplified by PC in ChIP assay (169 bp) Primers used for distal promoter PC Human embryonic kidney 293T cells GGACGGGGGAGGGGGACTGGAAAGCGGAAAC TTTCCTATAAAACTTCGAAAAGTCCCTCCTCCT CACGTCAGGCCAATGACACTGCTGCCCCCAAA CTTTCCGCCTGCACGGAGGTATAAGAGCCTCC AAGTCTGCAGCTCTCGCCCAACTCCCAGACAC CTCGCGGGCTCTGCAGCACCGGCACCGTTTCC AGGAGGCCTGGCGGG (-147~ +60 from TSS) CACGT (complementary strand: ACGTG), -83 ~ -79 from TSS GGAAGCTTGAGGGGGACTGGAAAGC CCCGCCAGATCTCCTGGAAACGGTG 1. PC amplification of TWIST proximal promoter from 293T genomic DNA followed by insertion into the HindIII/BglII enzyme sites of pxp2 luciferase reporter construct 2. Site-directed mutagenesis of HE (CACGT ACAGT) to establish pxp2-twist-mut construct CGGGGGAGGGGGACTGGAAAGCGGAAACTTT CCTATAAAACTTCGAAAAGTCCCTCCTCCTCA CGTCAGGCCAATGACACTGCTGCCCCCAAACT TTCCGCCTGCACGGAGGTATAAGAGCCTCCAA GTCTGCAGCTCTCGCCCAACTCCCAGACACCT CGCGGGCTCTGCAGCACCGGCACCGTTTCCAG GAGGCCT (-144 to + 54 from TSS) CGGGGGAGGGGGACTGGAAAGC AGGCCTCCTGGAAACGGTGCCG TACTCCAGCGCGGTGCACAAAACTCGTCGCCC CCAAACGCTGCCCCCACCCCAACACTGTGTAC TGACTCCAGCTTTTTACTTTGCCATGTAAGGGA TGGACCTGAAACGGTTATTTTACCTCAATTCAT TTCAAAAAGGAAACAAGTATGGCATTGCAAA AGATGGGC (-1383 to from TSS) TACTCCAGCGCGGTGCACAAAACT AACGAAGAGCCCCAAAGAGGGTGT EMSA Wild type CCTCCTCACGTCAGGCCA (-73 ~ -90 from TSS) oligonucleotide containing HE Mutant oligonucleotide CCTCCTACAGTCAGGCCA Abbreviation: ChIP, chromatin immunoprecipitation; EMSA, electrophoretic mobility shift assay; HE, hypoxia response element; TSS, transcription start site

9 cases Table S2. Characteristics and univariate survival analysis of 147 HNSCC Variables Case No. Median OS P Median S P (months) (months) Age <50 60 * * Gender male 138 * * female 9 * * T stage < ~2 68 * * 3~ N stage <0.001 < * * HI-1α overexpression <0.001 <0.001 Yes No 72 * * TWIST overexpression <0.001 <0.001 Yes No 95 * * Snail overexpression <0.001 <0.001 Yes No 92 * * Abbreviations: HNSCC, head and neck squamous cell carcinoma; OS, overall survival; S, relapse-free survival * Median survival was not reached.

10 Table S3. Correlation of the IHC expression gradient of HI-1α, TWIST, and Snail in primary tumor samples of 147 HNSCC cases HI-1α IHC gradient P TWIST IHC gradient Snail IHC gradient <0.001 <0.001

11 Table S4. Multivariate survival analysis Variables OS S Hazard ratio (95% CI) P Hazard ratio (95% CI) T stage(t3~4 vs. T1~2) (0.85 ~ 4.46) (0.61 ~ 3.10) N stage(n1-3 vs. N0) (1.32 ~ 4.88) (1.12 ~ 4.74) HI-1α/TWIST/Snail 5.08 < co-expression (3.87 ~11.10) (2.98 ~ 13.45) Abbreviations: OS, overall survival; S, relapse-free survival; CI, confidence interval. P <0.001

12 Table S5. Sequence of the oligonucleorides for sina construct-making, real-time PC, and ChIP assays Assays Sequence (5. 3 ) Amplicon (bp) sina eal-time PC ChIP HI-1α-si Twist-si Lox-si HI-1α VEG TWIST N-cadherin E-cadherin LOX Snail SIP1 Zeb1 E47 CXC4 GAPDH TWIST (proximal promoter) GATCCCCGAATTCTCAACCACAGTGCTTCAA- GAGAGCACTGTGGTTGAGAATTCTTTTTA GATCCCCAGGGCAAGCGCGGCAAGAATTCAA- GAGATTCTTGCCGCGCTTGCCCTTTTTTA GATCCCCGTTCCTGCGCTCAGTAACCTTCAA- GAGAGGTTACTGAGCGCAGGAACTTTTTTA TTTTTCAAGCAGTAGGAATTGGA GTGATGTAGTAGCTGCATGATCG CGCAAGAAATCCCGGTATAA TCTCCGCTCTGAGCAAGG AGCTACGCCTTCTCGGTCT CCTTCTCTGGAAACAATGACATC GGTGGAGGAGAAGAAGACCAG GGCATCAGGCTCCACAGT GGAACTATGAAAAGTGGGCTTG AAATTGCCAGGCTCAATGAC CCTGGGCTCACAGTACCAG GATCAGCAGGATCGGAGTG CTTCCAGCAGCCCTACGAC CGGTGGGGTTGAGGATCT AAAACCATGGCGTGGGTA CAATAGCCGAGGCATCAAC ACTGCTGGGAGGATGACAGA ATCCTGCTTCATCTGCCTGA GCATTGAGGCCTTGTGGA GGTAACGGTGGAGTCTCAGG GGATATAATGAAGTCACTATGGGAAA A GGGCACAAGAGAATTAATGTAGAAT TCCACTGGCGTCTTCACC GGCAGAGATGATGACCCTTTT CGGGGGAGGGGGACTGGAAAGC

13 AGGCCTCCTGGAAACGGTGCCG TWIST (distal promoter) TACTCCAGCGCGGTGCACAAAACT AACGAAGAGCCCCAAAGAGGGTGT 169 VEG promoter ACAGACGTTCCTTAGTGCTGG 262 AGCTGAGAACGGGAAGCTGTG

14 Table S6. List of proteins tested by antibodies and characteristics of the corresponding antibodies used Protein Assay Antibody Origin Dilution Incubation period HI-1α WB mmab #610958, BD Biosciences 1: 200 overnight HI-1α Supershift mmab #610958, BD Biosciences 1 µg 60 min HI-1α ChIP mmab #610958, 2.5 µg overnight BD Biosciences HI-1α IHC mmab #610958, BD Biosciences 1:50 overnight HI-1β Supershift mmab # , BD Biosciences 1 µg 60 min TWIST WB rpab sc-15303, Santa Cruz 1: 200 overnight TWIST IHC gpab sc-6070, Santa Cruz 1:50 overnight LOX WB rpab ab32138, Abcam, Inc 1: 500 overnight Snail WB rpab sc-82199, Santa Cruz 1:200 overnight SIP1 WB rpab sc-48789, Santa Cruz 1: 200 overnight Zeb1 WB gpab sc-10572, Santa Cruz 1: 200 overnight E47 WB mmab # , 1: 500 overnight BD Biosciences CXC4 WB rpab ab2074, Abcam, Inc 1: 500 overnight c-myc ChIP rpab sc-764, Santa Cruz 2.5 µg overnight HA ChIP mmab #2367, Cell Signaling 2.5 µg overnight Technology, Inc. E-cadherin WB rpab #4065, Cell Signaling 1:1000 overnight Technology, Inc. E-cadherin I rpab #4065, Cell Signaling 1:200 overnight Technology, Inc. E-cadherin IHC rpab #4065, Cell Signaling Technology, Inc. 1:100 overnight vimentin WB mmab V-6630, Sigma-Aldrich Corp., vimentin I mmab V-6630, Sigma-Aldrich Corp., vimentin IHC mmab V-6630, Sigma-Aldrich Corp., plakoglobin WB mmab sc-8415,santa Cruz N-cadherin WB rpab #610921, BD Biosciences 1:200 overnight 1:100 overnight 1:100 overnight 1: 200 overnight 1: 1000 overnight

15 CA IX IHC rpab sc-25599, Santa Cruz 1:50 overnight top3α WB gpab sc-26752, Santa Cruz 1:200 overnight ß-actin WB mmab A-5441, Sigma-Aldrich Corp., 1: hour Abbreviations: WB, Western blot; ChIP, chromatin immunoprecipitation; IHC, immunohistochemistry; I, immunofluorescence; mmab, mouse monoclonal antibody; rpab, rabbit polyclonal antibody; gpab, goat polyclonal antibody

16 Supplementary Method Equipments and settings The fluorescence images were captured using a Leica DME epifluorescence microscope equipped with a 40x PL fluoter oil objective. Images were collected sequentially on a confocal laser scanning microscope (LeiCa TCS SP2, Wetzlar, Germany) and analyzed by Leica Confocal Software. aw TI images were merged in Adobe Photoshop (Adobe Systems, Edinburg, U.K.) without background subtraction. The histology, immunohistochemistry and immunocytochemistry images were captured by a light microscope equipped with 5x N Plan and 40x HCX L Plan objectives (LeiCa DM 2500, Wetzlar, Germany). The acquisition software was QCapture (Qimaging Inc., Surrey, Canada). The depth of captured image was 10 bit.