Labelling techniques, Detection, Blotting and

Transcription

1 Identification of cloned DNA Gene library screening, Genetic transformed organism Labelling techniques, Detection, Blotting and hybridization techniques

2 DNA Denaturation and hybridization Denaturation is by 1. Heat: Tm 2. Low ion concentration 3. Agents destabilizing h-bonds like alkaline solution, formamid, urea etc

3 DNA hybridization Complementary NA strands hybridize Potentially any two NA strand can hybridize. Two DNA strands, two RNA strands or DNA and RNA strands may hbd hybridize. Mostly they are unstable as only few inter strand bonds are formed. Complementary strand hybridize and form stable ds NA hybridization is used to identify a clone if its complementary probe is available Fig. 8.8

4 Labelling techniques The labelled NA is called probe,, which identify the cloned DNA or RNA of cell Labelled DNAs are used in hybridization and DNA sequencing. The labelled ll probe may be: oligo-, DNA-, and RNA-probe RNA-probe is produced by in vitro transcription.

5 Labelled probes are produced according to its future use: the probe may be oligonucleotide, RNA or DNA Traditionally the probe is labelled with radioactive nucleotide Radioactive labelling is not favourable because of the hazard to the researcher and problem in disposal. Methods of nonradioactive labelling are also developed, which is being popular as its sensitivity is improving. Probes are used for NA hybridization: most stable is RNA-RNA hybrid followed by RNA-DNA hybrid and DNA-DNA binding is most week.

6 Probes are prepared from From the DNA sequence, if known From cdna sequence if available From AA sequence of the protein coded d by the Gene if partially or completely known From gene of related species if known From gene of related genes of same family

7 Radioactive vs non-radioactive labelling Radioactive labelling: The marking is used since long so effective methods are available Advantages: highly sensitive, direct method of analysing, Expose to photographic film give the result, reliable quantitative measurement possible by scintillation counter. Disadvantages: Radioactive rays are the problem, health hazardous so should work always protected from radioactive rays. The half life of radioactive element is another problem so the marked probe should be used soon. Special permission necessary for lab to work with radioactive, disposal of waste. Nucleic acid probe are marked by either 32 P or 35 S, with short half life-should be used soon

8 Non-radioactive labelling Advantages The labelled probe also remains intact for long time for years. The probe can be used repeatedly. Disadvantages Quantitative assessment is hard as the test is indirect and dependent not directly on the probe but from certain reaction. Low sensitivity compared to radioactive labelling Biotin and digoxiginine are widely used for labelling DNA or RNA- labelled dutp is used DNA polymerase incorporates labelled dutp also.

9 Radioactivel labelling NA distinguished by special label- radioactive Radioactive isotopes 32 P or 35 S are used 32 P : Half life 14 days must be used soon-phosphate nuucleotide 35 S : half-life life 88 days, so remain active for relatively long period- phosphorothioate Nt Quantitative assay possible 35 S-labelling better: long half life, lower energy and produce more precise band not so fuzzy

10 Radioactive labelled DNA. Comparison between labelling with radioactive phosphorus and radioactive sulfur. Fluorescent labelling is done by attaching fluorescent dye in case of DNA sequencing

11 Non-radioactive Biotin labelling lli Biotin and digoxigenin two molecular tags widely used for NA labelling. Linked with Uracil, so for DNA uracil is incorporated instead of thymine DNA polymerase do not incorporate UTP but labelled DeoxyUTP is incorporated instead of dttp Digoxigenin

12 Digoxigenin labelling: Digoxigenin dutp is incorporated in probe DNA or RNA Antidig (antibody to digoxigenin) conjugated with alkaline phosphatase binds with dig labelled DNA. Chromogenic detection: By the action of enzyme produce coloured substance. BCIP (5 Bromo-4-chloro- 3-Indol phosphate) p and NBT( nitoblue tetrazolium chloride) when added the enzyme react and produce substance purple blue in colour. Chemiluminescent detection: Substrate by the action of enzyme produce light emitting unstable luminescent group. Detected by autoradiography. Detection may take few minutes to some hours according to the labelling and hybridization. Biotin/streptavidin labeling works under similar theory.

13 Labelling of DNA Biotin and digoxigenin linked uracil is incorporated in nucleotide and used for DNA or RNA synhesis. Non radioactive and not coloured or fluorescent Egg protein avidin binds biotin used to trace biotin bound uracil Digoxigenin also require second detectable molecule-antidig antibody binding The avidin and antibody are attached with detection system that enables to detect the labelled NA

14 Methods of Producing labelled NA Nick translation Produce labelled dsdna probe Single strand Nick is introduced in template DNA at widely separated site by DNAse I DNA polymerase incorporates Nucleotide at free 3 OH produced by nick. ik The 5 t to 3 exonuclease activity remove nucleotides causing movement of nick- the nick translation.

15 When nicks on opposite strands meet, the DNA molecule l breaks. During nick translation if some radioactive nucleotide provided d with dntps, radioactive nucleotide will be incorporated in the new strand: α 32 P-dNTP should be used as the radioactive nucleotide. Biotin or digoxigenin conjugated UTP are widely used for non-radioactive labelling Unincorporated dntps are separated by sephadex column Fluorescent labelled nucleotide will produce fluorescent labelled DNA

16 Nick translation Nick translation and labelling of DNA fragment

17 Random Primed labelling Template DNA denatured ed Polymerase reaction in presence of random primers, Klenow fragment and labelled or non- labelled nucleotides are used Probe DNA by extension of the primer will be produced.

18 End labelling 5 -end labelling Exchange of phosphate of 5 end with radioactive phosphate: first dephosphorylation and then rephosphorylation. Oligonucleotide are labeled by this method Dephosphorylation by alkaline phosphatase and rephosphorylation of 5 OH end T4 polynucleotide kinase adds phosphate group if γ 32P dntp is used the added P is radioactive.

19 3 end labeling The enzyme used is Terminal deoxynucleotide transferase Add nucleotides at 3 end (it do not need complementary strand) If dedeoxynucleotide with radioactive P is used only one nucleotide is added.

20 PCR-method Large amount of DNA probe can be produced from very small amount of template By using specific primers only specific DNA sequence can be amplified from mixed DNA. PCR is run with labelled ll and normal dntps. Incorporation of labelled dntp during polymerase reaction produce new labelled ll DNA strands.

21 RNA probe: labelled specific RNA Labelled like in DNA In vitro transcription DNA cloned in a vector like pgem3z or pblue script, which h consists of viral T7 or sp6 promoter Produce RNA when T7 polymerase is provided Use of nucleotide- radioactive or nonradioactive produce RNA probe

22 Detection of radio-labelled ll d DNA Scintillation counting: measure amount of radioactivity if sample in liquid or on stripe filter Scintillants: chemical emits light tw when high energy e electrons -β-particles- released from the radioactive isotopes in DNA strikes it The light is detected by photocell. Scintillation counter, a sensitive device record faint light pulses. Also use to measure the luminescent sample

23 Autoradiography For detecting labelled DNA or RNA in Gel. NA bands separated in Gel Hybridized with radioactive probe exposed to photographic film NA bands in gel are first transferred to solid support- membrane (nylon or nitrocellulose) NA transferred to membrane hybridized with radioactive probe- exposed to photographic film Radioactive NA emits β-particles l and expose radioactive film in position of NA

24 Detection of non-radioactive labelled DNA Separated bands trnsfered to solid support and hybridized with probe Two methods: colour or light production. An enzyme is atached to the avidin or antidig antibody Colour production: Alkaline phosphate p attached to avidin or dig cleaves phosphate group from cromogenic substanc and produce coloured substance An artificial chromogenic substance X-phos produce blue dye and help to trace the labelled NA

25 NBT/BCIP reaction (blue-purple precipitates) NBT (nitroblue tetrazolium chloride) is an oxidant and BCIP (5-Bromo-4-Chloro Chloro-3' 3'-Indolphosphate p- Toluidine Salt) is the substrate for AP BCIP is hydrolyzed by alkaline phosphatase to form an intermediate that undergoes dimerization to produce an indigo dye. The NBT is reduced to the NBT-formazan by the two reducing equivalents generated by the dimerization.

26 Chemiluminescence i Light is produced by chemical reaction AP attached to avidin/dig-antibody antibody cleaves certain substance like lumi-phos (light emitting chemical bound to phosphate). AP cleaves P and the unstable luminescent group emits light. The light emission is detected by exposing to photographic hi film or scanned by an instrument capable of detecting light emission.

27 Blotting and hybridization techniques Performed for Gene G library screening-for clone identification Presence of particular DNA in Genetic transformed organism-test Expression i analysis

28 Methods for clone identification (using nucleic acid probe or analysing protein product) The process of identifying particular clone containing the gene of interest from the gene library: Screening Nucleic acid hybridization: colony or plaque hybridization Hybrid arrest and release Chromosome walking (Repeat screening) Immunoscreening

29 Library screening (Searching the genes of interest in a DNA library) Hybridization to identify the interested DNA or its RNA product Labelled probes, which is complementary to a region of the interested gene is used Probes: An oligonucleotide derived from the sequence of a protein product of the gene A DNA fragment/oligo from a related gene of another species Homologous or heterologous Blotting the DNA or RNA on a membrane Hybridize the labeled probe with DNA membrane (Southern) or RNA membrane (Northern)

30 Colony and plaque hybridization Transfer the DNA in the plaque or colony to a Nylon or nitrocellulose membrane Phage DNA bind to Bacterial colonies must be lysed to the membrane directly release DNA on the membrane surface. (Alkali treatment) Hybridization (in a solution Containing Nucleic acid probe) Line up the hybridizated region or repeated hybridization Wash to remove unhybri- dization probe and visualize X-ray film(radio- actively labeled ) antibody or enzyme (modified nucleotide labeled

31 Colonies hybridization and detection of clone using radioactive probe

32 Probe is labeled with radioactive 32 P 32 P Hybridization AGTCCTCCGTTCT GGGGACGAG AGGCAT GCTCAGGAGGCAAGAGGC TCCCCTGCTCA GGATCCATCCCC TTC G DNA denaturation Target gene Single colony Lysed

33 General Procedure: Screening DNA Library

34 Colony Is Screened by Hybridization with Probe Colony hybridization Cover with filter paper Transferring Autoradiography Collect filter paper Dissolve cell DNA denatured Add probe

35 Transfer to nitrocellulose or nylon membrane Keep master plate Select positive from master plate Denature DNA(NaOH) Bake onto membrane Probe with 32 p-labled DNA complementary to gene of interest Expose to film Screening by plaque hybridization

36 Results of Genomic library screening High density screening First membrane Duplicate membrane

37 Second Low density screening

38 CTCAGGAGGCAAGAGG Probe is labeled with radioactive 32 P Hybridization 32 GGGGACGAGTCCTCCGTTCT GGGGAC P AGGCAT ATCCCCTGCTCAG GGATCCATCC DNA Target gene denaturation Single colony Lysed

39 Expression screening (for expression library) Test for expression of cloned gene Expression of gene is proved by the presence of specific mrna transcribed by the gene or by the presence of protein translated from the mrna. The cloned gene to be expressed is not normally present in the host cell mrna is shown by Northern Blot Protein: imunological method called immunoscreening in case of library screening.

40 Immunoscreening Identify the protein product of an interested gene If the inserts are cloned into an expression sites, it may be expressed. Therefore, we can screen for the expressed proteins. 1. Protein activity 2. Western blotting using a specific antibody

41 Labelled probe: Pr. Antibody Sec. antibody Protein A For immunological detection antibodies of new protein produced are required. Expression of cloned gene identified by detecting the protein produced. Protein transferred to polyvinyl or nitrocellulose membrane Protein not related to the protein of interest is attached to the empty space of Membrane Antibody of the protein (or its epitope) used as probe to detect the protein in the membrane Primary antibody washed and finally washed with labelled secondary antibody Detection by autoradiography or colour reaction

42 Expression screening Antibodies can be used to screen the expression library. The procedure has similarities to the plaque hybridization protocol. Plaque lift ( taken by placing a membrane on the dish of plaque) Immersed in a solution of the primary antibody Detected by secondary conjugated antibodies (alkaline phosphatase or horseradishperoxidase) Repeat cycles of screening to isolate pure plaques

43 Results of imunoscreening High density screening with about 2000 pfu (up to 40,000 plaques) First membrane 1st plate plate Duplicate Duplicate membrane

44 First low density screening 1st plate Duplicate membrane

45 Second low density screening First membrane 1 st plate Duplicate membrane Duplicate plate

46 Blotting and hybridization techniques NA/protein separated in gel and transferred to membrane NA/protein is traced by hybridization with labelled probe of specific part of NA/protein. Used to locate certain sequence of nucleic acid or protein in the total nucleic acid and protein molecules extracted and separated by electrophoresis. It is a main molecular method to prove the presence of nucleic acid or protein in certain cells or tissues. The NA or protein molecules are first separated by electrophoresis and their bands are immobilized in a solid support (Nitrocellulose or nylon membrane) Labelled samples are used to locate the specific sequence in the chromatogram by hybridization The labelled sample hybridizes only with the specific sequence.

47 Various techniques are developed. All go steps like transfer to membrane, immobilization, hybridization with specific probe and visual test. The common transfer technique are Southern Blotting (Tracing particular DNA fragment) Northen Blotting (RNA tracing- for expression analysis) Western Blotting (Protein tracing- for expression analysis) Colony hybridization (Trace right clone) Dot blot (concentration estimation) In situ hybridization (location of expression) All blotting techniques work in same principle

48 Southern blotting (Southern, 1975) To trace the presence of specific DNA sequence. Used to locate the position of gene on a small DNA fragments Principle DNA is first cleaved in to small fragments and separated in an agarose gel. Denaturation of DNA Blotting on nylon or nitrocellulose membrane Annealing in presence of labelled probe. Autoradiography to trace the searched sequence of DNA.

49 Procedure DNA fragmentation and blotting DNA cleaved with restriction enzyme or enzymes Separation in agarose gel/polyacrylamid gel Denaturation of DNA by dipping gel in alkaline solution Single stranded DNA transferred to nitrocellulose or nylon membrane by mechanical capillary transfer method or by using electric current (electro blot). Fragments of DNA fixed in membrane by placing 2 h at 80 o C or by UV cross linking

50 Southern Blotting can detect 0.1 pg of the DNA Detection of DNA

51 Detection of DNA fragments Hybridization and labelling reaction: probe may be labelled single stranded DNA (or RNA). Oligonucleotides of 100 to 1000 bp are used as probe. It should be minimum 18 bp. DNA probe used in Southern Blot- Denatured before use. The probe may be labelled by radioactive or non radioactive method a. 32 P (radioactive) b. Biotin (non radioactive), i c. Digoxigenin i i (non radioactive) i The probe will hybridize only with complementary DNA sequence attached to blot. Altering the concentrations of formamide, SSC, and SDS affects "stringency," or specificity. Dried milk, heparin, detergent (SDS) are used to repress unspecific hybridization. Washed thoroughly Detection of fragments of searched DNA by autoradiography (for radioactive or chemiluminicent probe) or by colour reaction.

52 PCR techniques Used when DNA sequence fully or partially known. Appropriate primer selection and PCR help to identify the clone. PCR should run for each clone separately so is time consuming.

53 References T.A.Brown: T A Gene cloning and DNA analysis A.Kumar and N-Garg: Genetic engineering Chaula: l Plant biotechnology Sambrook: Molecular cloning D.W.S. Wong: The ABC of Gene cloning Lodisch et al: Molecular cell biology