Engineering splicing factors with designed specificities

Transcription

1 nature methods Engineering splicing factors with designed specificities Yang Wang, Cheom-Gil Cheong, Traci M Tanaka Hall & Zefeng Wang Supplementary figures and text: Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4 Supplementary Figure 5 Supplementary Figure 6 Supplementary Table 1 Correlation of ESF activities with the binding affinity of their domains to the target sequences Activities of ESFs in HeLa cells Increased amount of ESF expression can modulate splicing in sequence nonspecific fashion domain alone does not affect splicing Binding affinity between (531) and Bcl-x RNA sequence Detection of Bcl-xL and Bcl-xS protein in same Western blot after the ESF transfection Primers used in constructing ESF expression vectors

2 Fig. 1 Fold Change of Exon inclusion RS-Puf Gly-Puf RNA-protein binding affinity (-log K d ) Fig. 1. Correlation of ESF activities with the binding affinity of their domains to the target sequences. All combinations of ESFs and exon-skipping reporters containing cognate 8- nt target sequences (listed in Fig. 1 of the main text) were co-transfected into 293T cells, and inclusion of the test exon was detected with RT-PCR and quantified as the relative fold changes compared to no ESF samples. The fold changes (i.e. ESF activities) were plotted against the binding affinity between target 8-mers and ESF domains, indicated as -logarithm of K d (mm). Data are from experiments shown in Fig. 1 of the main text, and the means of replicated experiments are plotted with error bars indicating the range. RS- type ESFs are shown in green and Gly- type ESFs in red.

3 Fig. 2 a Gly Fold Change UGUAUAUA (NRE) UGUAUGUA (A6G) UUGAUAUA (GU/UG) Target sequence b RS 4 UGUAUAUA (NRE) UGUAUGUA (A6G) UUGAUAUA (GU/UG) Target sequence Fold Change 2 0 Fig. 2. Activities of ESFs in HeLa cells. (a) Inhibition of exon inclusion by Gly- type of ESFs in exon-skipping reporters containing 8-nt cognate targets in the cassette exon (yellow). All combinations of splicing reporters and the ESF expression vectors were co-transfected into HeLa cells, and the skipping of the cassette exon was detected with body-labeled RT-PCR. Experimental procedures are as in Fig. 1 of the main text, except HeLa cells were used instead of 293T cells. Fold changes of cassette exon inclusion relative to the reporters alone (none ESF) were quantified and plotted below the gel. (b) Promotion of exon inclusion of exon-skipping reporters by RS- type ESFs in Hela cells. All experimental conditions and quantification methods are similar to panel a (also see Fig. 1 in the main text for experimental details).

4 Fig. 3 a b 0.02 µg 0.1 µg 0.2 µg 0.4 µg A6G as inserted target Gly U G U A U G U A ( A 6 G ) Fig. 3. Increased amount of ESF expression can modulate splicing in sequence nonspecific fashion. (A) Diagram of titration experiment. The Gly- type ESFs were cotransfected with an exon-skipping reporters containing 8nt sequence A6G (UGUAUGUA, the cognate target of 3-2 ) in the cassette exon. Different amounts of three ESF expression vectors were co-transfected with 0.2 μg splicing reporter into 293T cells, and the skipping of the cassette exon was detected with body-labeled RT-PCR using primers corresponding to exons 1 and 2 of the reporter minigene. (B) Exon skipping caused by increased amounts of ESFs. At the low amounts (0.02 μg ), the inhibition effect of exon inclusion by ESFs is sequence specific as only the Gly- 3-2 that bind to A6G target clearly increases the exon skipping. With the increased amounts of ESF vectors, all ESFs can cause exon skipping even between the low affinity -RNA pairs, leading to a sequence non-specific effect in splicing modulation.

5 Fig. 4 a Gly UGUAUAUA (NRE) UGUAUGUA (A6G) UUGAUAUA (GU/UG) b Bcl-xL Bcl-xS Fig. 4. domain alone does not affect splicing. (a) Expression plasmids of Gly- type of ESF (left panel) or domain (right panel ) was co-transfected into 293 cells with an exon-skipping reporters containing the cognate target in the cassette exon (left). The inclusion of the cassette exon was detected with body-labeled RT-PCR using primers corresponding to exons 1 and 2 of the reporter. In all reporters containing different target sequences (shown below the gel), the co-expression of domain alone (lanes 2, 5, 8) produced same levels of exon inclusion as the none trans-factor control (lanes 1, 4, 7). As a positive control, the co-expression of Gly-s can decrease inclusion of exon that containing their targets (lanes 3, 6, 9). (b) The expression plasmids of 531, Gly- wt (negative control), Gly- 531 (positive control) were transfected into MDA-MB-231 cells, and the Bcl-x splicing was detected by RT-PCR. Experimental conditions are same as Fig. 4 in main text.

6 Fig. 5 a Protein:RNA Complex Unbound RNA 17.3 nm 8.66 nm 4.33 nm 2.16 nm 1.08 nm 541 pm 271 pm 135 pm 67.6 pm 33.8 pm 16.9 pm 8.45 pm 4.22 pm 2.11 pm 1.06 pm 0.53 pm 0.26 pm 0.13 pm 0.07 pm 0.03 pm b Fraction bound [Protein], nm Fig. 5. Binding affinity between 531 and Bcl-x RNA sequence. (a) Representative electrophoretic mobility shift assay (EMSA) performed with indicated concentrations of 531 protein and ~2 pm radiolabeled target RNA (5 -CCAGAAUUGUGCGUGUUCG-3, Bcl-x target sequence is underlined). (b) Representative analysis of EMSA data shown in panel A. A plot of the best-fit binding isotherm is shown (solid line). Wild-type protein binds to the Bcl-x target sequence with a K d of 660 ±17 nm.

7 Fig. 6 Gly μg 0.2μg 1μg Bcl-xL Bcl-xS Tubulin Anti-Flag Fig. 6. Detection of Bcl-xL and Bcl-xS protein in same Western blot after the ESF transfection. HeLa cells were transfected with different amounts of the Gly- 531 expression construct. Gly- wt was used as a control. The experimental condition are same as Figure 3 in main text. The expression of ESFs is detected with anti-flag antibody, and the tubulin level is used as control. The blot was exposed at a longer time to detect both Bcl-xS and BclxL in the same blot, as the available Bcl-x antibody can detect Bcl-xL with much higher sensitivity. Same blot with different exposure time was shown in Fig. 4 of the main text.

8 Supplementary Table 1: Primers used in constructing ESF expression vectors (restriction enzyme digestion sites are underlined) Primer name Sequence Notes Pum-F1 CACGGATCCTCCCCCCCAAGAAAAAGAGG AAGGTATCTAGAGGCCGCAGCCGCCTTTTG Encodes NLS between BamHI and XbaI sites Pum-R1 GTGGTCGACTTACCCTAAGTCAACACC Encodes a stop ASF-RS-F ASF-RS-R CACGCTAGCATGGACTACAAGGACGACGA TGACAAGGGTCTCGAGAGAAGTCCAAGTT ATGGAAG CACGGATCCCCGTACGAGAGCGAGATCTG codon and SalI site Encodes an N- terminal FLAG tag after NheI site Contains BamHI site for cloning