shrna experiment design

Transcription

1 shrna experiment design 鄭金松 Core Manager

2 Comparison of sirna and shrna Structure sirna (19-27 nts) shrna (19-27 nts) Advantage vs. disadvantage cost delivery efficiency duration of knockdown renewability

3 Long dsrnas trigger non-specific silencing in mammalian dsrna C. elegans Drosophila In mammal? IFN response in mammalian system global gene silencing

4 RNAi Effective Molecule 長雙股 RNA (long dsrna) cytosol nts Dicer was identified responsible for choping dsrna into little pieces of RNA. sirna small-interfering RNA; sirna - Nature. 2000;404:293-6; Nature. 2001;409:363-6

5 Nature 411, (24 May 2001) Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells Sayda M. Elbashir 1, Jens Harborth 2, Winfried Lendeckel 1, Abdullah Yalcin 1, Klaus Weber 2 and Thomas Tuschl 1 Department of Cellular Biochemistry; and Department of Biochemistry and Cell Biology, Max-Planck Planck-Institute for Biophysical Chemistry, Am Fassberg 11, D D Göttingen,, Germany Worked with Dharmacon to offer this know-how to the public

6 Strand bias selection during upload of sirna Guide/ antisense strand

7 sirna design: from empirical to rational 19-nt duplex region 3 -OH P A U xg A P-5 3 -OH High thermal stability of the 5 sense strand (SS) blocks incorporation of SS into RISC. G or C is preferred. Low thermal stability of the 5 anti-sense strand (AS) promotes Incorporation of AS into RISC. AU rich is suggested. Low stability in this region enhances RISC/AS-mediated cleavage of mrna and promote RISC complex release. U at position 10 at SS is recommended. Sense strand Antisense strand Renolds et al. 2003

8 Other considerations no high GC content (35-65%); no inverted repeat sequence; no consecutive 3 Gs or 3 Cs; no consecutive 4 Ts if use poliii promoter; mrna secondary structure?

9 Biogenesis of mi/sirnas shrna Nature Review: 5: 522, 2004

10 Expression of Hairpin RNA (shrna( shrna) Using Pol III Promoters Transcription initiation of DNA-dependent RNApol III promoters (U6 or H1) are well characterized. RNApol III transcription uses a well-defined termination signal (TTTTT) and the products have no extra sequence. Transcription from these promoters is very efficient in various tissues.

11 Configuration/Structure of hu6 Promoter -23 DSE 250bp PSE TATATAT

12 In vivo synthesis of sirna through shrna sirna RNAi machinary shrna

13 Vector Used by TRC/RNAi RNAi Core AgeI (ACCGGT) EcoRI (GAATTC)

14 shrna Structure of TRC RNAi

15 Library performance-i (11,466 TRC shrnas targeting 1,956 genes) 5, % % # clones 4,000 3,000 2,000 1,000 44% 80% 60% 40% 20% Cumulative % clones # genes % 75% 80% 60% 40% 20% Cumulative % genes 0 <10% <20% <30% <50% no KD 0% Clone Performance (% Expression) 0 100% 80% 60% 40% 20% <20% 5/5 4/5 3/5 2/5 1/5 0/5 % "good" clones/gene 0% TRC report

16 Library performance-ii (11,466 TRC shrnas targeting 1,956 genes) # shrnas A549 MCF7 Jurkat Hepa 10% 20% 30% 40% 50% >50% KD bin (% remaining) 100% 90% 80% 70% 60% 50% 40% 30% 20% 10% 0% cumulative % shrnas TRC report

17 shrna vector provided by RNAi Core Psi sequence SD pbs HIV 5'-LTR RSV Promoter RRE U6 promoter plko AS bp Txn Initiation Bsm BI (245) Bsm BI (284) SV40ep EM7p Puromycin PPT partial U3 HIV 3'-LTR CMViep CMViep EGFP DsRed SV40 PolyA Ori Amp bla promoter

18 shrna Lentiviral transfer vectors co-expressing fluorescence protein Day 4 p.i. Day 7 p.i. pas1_egfp pas1_dsred

19 How to Insert mirna or shrna into plko_as1 Vector A PCR-Based Cloning Method: BsmBI-digested plko_as1 vector will produce two 5 -protruding ends with different sequences. BsmBI agacgcaccagagacgtggttttttttgctagcttgccgtctccatgatgt tctgcgtggtctctgcaccaaaaaaaacgatcgaacggcagaggtactaca BsmBI BsmBI digestion agacg caccagagacgtggttttttttgctagcttgccgtctcc atgatgt tctgcgtgg tctctgcaccaaaaaaaacgatcgaacggcagaggtact aca Vector left arm Replaced by shrna Vector right arm

20 How to Design Oligonucletides for PCR shrna sequence followed by TTTTT is flanked with common 5 5 and 3 3 end sequences that include two BsmBI BI recognition sites (Bsm( BsmBI-restricted PCR fragments will ligate to BsmBI BI-restricted plko_as1 vector. 5 -tctctagatcaacagcgtctctcaccgg-shrna- 3 -agagatctagttgtcgcagagagtggcc-shrna- shrna: antisense sequence loop sense sequence Loop sequence: tgagtagattagcaat

21 Thermodynamic Stability Profiling of Human pri-mirnas mirnas 5 -Donors 157 pri-mirnas

22 shrna structure with hmirna loop sequence Antisense/guide strand Sense/passenger strand

23 Agarose Gel Analysis of PCR Products Amplified from Hairpin Containing Insert 100 bp marker 100 bp M PCR products 2. BsmBI BI-digested 3. Purified products (3% agarose) Tips Agarose: NuSieve 3:1 agarose DNA Purification Kit: Qiagen MinElute Gel Extraction Kit

24 How to Insert mirna or shrna into plko.1 Vector (annealing method) Oligo: 100μM sense & antisense (purified by PAGE) Annealing: sense 20μl antisense 20μl 10X buffer 4.5μl 10X Annealing Buffer: 1M K-acetateK 0.3M HEPES-KOH ph7.4 20mM Mg-acetate 95 0 C 3min 1 cycle 80 0 C 10min 1 cycle decrease to 4 0 C slowly ( C / sec) take 2μl 2 l of annealed oligos plus 50ng AgeI/ I/EcoRI-restricted and plko.1 vector to perform ligation and transformation.

25 Maps of lentivirus-based cdna expression transfer vectors plko_as2 5 LTR CMViep EMCV IRES2 3 LTR SV40 pa plko_as3.1.egfp3 CAGp bsd, hyg, neo, puro, zeo = multiple cloning sites EGFP CAG promoter: a chimeric promoter of CMV enhancer and beta actin promoter

26 GFP as a sorting marker for establishing stable line in transduced cells AS.3.1.EGFP5 Phase EGFP AS.3.1.EGFP3

27 Thank You!