supplementary information

Transcription

1 DOI: /ncb1862 Figure S1 Identification of SCAI as a Dia1 associating factor. (a) Identification of SCAI (Riken cdna I02) as a Dia1-FH3 interacting protein. Mouse brain lysate was incubated with GST-beads loaded with GST, Dia1-FH1, -FH2 or FH3. Bound proteins were eluted using 500 mm NaCl, precipitated with isopropanol and analyzed by SDS-PAGE using colloidal coomassie. Bands of interest were excised and analyzed by MALDI-TOF. (b) SCAI co-immunoprecipitates with Dia1. Myc-tagged SCAI and indicated Dia1 constructs were transfected into HEK293 cells. Cells were lysed after 48 h and subjected to immunoprecipitation using myc-agarose. Immuncomplexes were washed 4 x with lysis buffer and analyzed by immunoblot analysis using the indicated antibodies. (c) SCAI binds to the FH3 domain of Dia1 in vitro. SCAI and mutant SCAI versions were transfected into HEK293 cells and immunoprecipitated with Flag-agarose. Immuncomplexes were washed 4 x with RIPA containing 500 mm NaCl and finally once with binding-buffer (PBS, 1% TX-100, 1 mm EDTA). 2 µg of purified GST-FH1 or -FH3 was added in a final volume of 400 µl of binding-buffer and the reaction was incubated for another 30 min at 4 C with gentle shaking. Immuncomplexes were washed 4 x with binding-buffer and subjected to immunoblot analysis using the indicated antibodies. (d) Expression of Dia1 does not change the subcellular distribution of SCAI. NIH3T3 cells were co-transfected with myc-tagged SCAI and GFP or GFP-Dia1ΔDAD. Cells were fixed with 4% formaldehyde after 48 h, permeabelized and blocked with 5% FBS. Transfected cells were visualized using myc-specific antibodies followed by TRITC-labeled secondary goat anti-mouse antibodies and DAPI. Scale bar, 20 µm. (e) The subcellular distribution of myc-scai of GFP expressing cells was analyzed like described in Figure 4. Quantification is given from two independent experiments with a total number of 100 cells analyzed for each experiment (+/-S.D). 1

2 Figure S2 SCAI-Protein sequence alignment shows conserved elements in different species. Sequences were identified by using the mouse SCAI-Protein sequence and SIB BLAST Network Service. Multiple protein sequence alignment was performed using the ClustalW2 program, where * indicates identical (green), : indicates conserved (yellow) and. indicates semi-conserved amino acid residues with respect to all investigated species. Mus.mus.: mus musculus, Hom.sap.: homo sapiens, Dan.rer: Danio rerio, Dro.mel.: Drosophila melanogaster, Dic.dis.: Dictyostelium discoideum, Ara.thal.: Arabidopsis thaliana. 2

3 Figure S3 Comparison of endogenous SCAI and GFP-SCAI localization. Swiss3T3 cells were transfected with GFP-SCAI (white arrows) and processed for immunfluorescence analysis as described for Figure 1 (e). Cells were incubated with rat monoclonal antibodies for SCAI followed by incubation with secondary anti rat antibodies (red). Scale bar, 10 µm. 3

4 Figure 3d Figure 3e Figure 3g Figure 3f IB: β actin IB: β actin Figure 3h Figure 5c li. IB: SRF IB: myc Figure 7c IB: SCAI IB: α-tubulin IB: β1-integrin IB: β actin Figure 8b IB: HA/Flag Figure 8c IB:HA Figure 8d Figure S4 Full scans of key Western blots from indicates figures are shown. 4

5 Supplementary Table Affymetrix gene array analysis (HG U133 Plus 2.0) of MDA-MB231 cells after transfection by control sirna or SCAI sirna; analyses were performed in triplicate (#1 - #3). Genes upregulated or downregulated by a mean of at least 2-fold are shown. 5

6 GST Pull-Down Assays GST pull-down experiments were carried out in 10 mm Tris ph 7.4, 100 mm NaCl, 0.2 mm CaCl 2, 5% Glycerol 0.5% Triton X-100, 0.2 mm DTT, 1 mm NaF, 2 mm Na 3 VO 4 and proteinase inhibitors. Swinholide A (100 nm) was added to the binding reaction. To obtain cytosolic and nuclear extracts, cells were scraped in PBS and collected by centrifugation. The cell pellet was kept at -80 C for at least 45 min, resuspended in Buffer P1 (10 mm KCl, 0.1 mm EGTA, 1 mm DTT and proteinase inhibitors) and kept on ice for 15 min. Triton X-100 was added at 4% and the suspension was vortexed briefly. The cell suspension was centrifuged at g for 10 min at 4 C and the supernatant was recovered (cytosolic fraction). The pellet was washed once with P1 and resuspended in Buffer P2 (20 mm Hepes- KOH ph 7.9, 25% Glycerin, 400 mm NaCl, 1 mm EGTA, 1 mm DTT and proteinase inhibitors). The reaction was incubated for 90 min at 4 C with gentle shaking and centrifuged at g for 30 min. The supernatant, containing the nuclear proteins, was subjected to immunoprecipitation using the indicated antibodies and processed for immunoblot-analysis. RNA Analysis and Quantitative RT-PCR Total RNA was extracted using Trizol reagent (Invitrogen) and purified using the RNAeasy kit from Qiagen according to the manufacturer s recommendations. 1 µg of RNA was used as a template for reverse transcription with random hexamer primers using Revert Aid M-MuLV Reverse Transcriptase (Fermentas). Quantitative PCR was performed in triplicates using SYBR green (Biorad). PCR efficiency was assessed by serial dilution and relative abundances of template cdna were calculated by the comparative CT (ΔΔCT) method, normalized to the abundance of the GAPDH cdna. Primer sequences used were: hgapdh forward 5 cccttcattgacctcaacta; hgapdh reverse 5 ccaaagttgtcatggatgac; hscai (Gel) forward 5 caggttaagttcagtgaactaac; hscai reverse 5 cctggtgaaaggatagagatc; hscai (qpcr) forward

7 5 cgggaaacacgaaattatcc; hscai (qpcr) reverse 5 gcttctggagatgaggattctc; hintegrin β-1 forward 5 acagcagagaagctcaagcc; hintegrin β-1 reverse 5 gagcttagctggtgttgtgc. Microarray analysis First strand cdna synthesis was performed with 15 µg of total RNA and HPLC-purified T7 Oligo (dt) 24 primer (Ambion, Darmstadt, Germany). Biotin-labeled crna was synthesized by the ENZO RNA transcript labeling kit (Affymetrix, Santa Clara, CA). Hybridization was performed with 15 µg of fragmented crna on the Human Genome U133 Plus 2.0 array (Affymetrix) at 45 C for 16 h. Washing and staining by streptavidin-phycoerythrin was performed on a microfluide workstation (Affymetrix) and arrays were scanned by a laser scanner (Agilent Technologies, Böblingen, Germany). Quality controls were performed applying the Affymetrix Microarray Suite 5.0 (MAS 5.0) and GeneSpring software demonstrating comparable distributions of signal intensities between all arrays for subsequent gene expression comparisons. β1-integrin surface expression analysis For β1-integrin surface expression analysis 100,000 cells were suspended in modified Tyrode s buffer (137 mm NaCl, 2.7 mm KCl, 12 mm NaHCO 3, 5 mm HEPES, 1 mm MgCl 2, 0.5 mm CaCl 2, 0.1% glucose, ph 7.4) and fixed with the addition of 1 volume of 4% paraformaldehyde in PBS containing 1 mm MgCl 2 on ice. The fixing solution was removed, the cells were resuspended in modified Tyrode s buffer and incubated for 1 h on ice with active β1-integrin recognizing antibody 12G10 (Abcam) or 9EG7 (BD Pharmingen) or total β1-integrin recognizing antibody P5D2 (Developmental Studies Hybridoma Bank) or K20 (Beckman Coulter). The negative control was secondary antibody alone. After secondary antibody incubation (anti-mouse or anti-rat Alexa-647), cells were washed once with 1 ml PBS and analyzed with BD FACSArray Bioanalyzer (BD Biosciences, CA, USA.)