Nanoparticle-based DNA multiplexed probes for pathogen detection using confocal raman microscopy

Transcription

1 /4/27 Nanoparticle-based DNA multiplexed probes for pathogen detection using confocal raman microscopy PI: Joseph Irudayaraj, Purdue University Collaborator: Chobi Debroy, Penn State University Graduate Researcher: Lan Sun Agricultural and Biological Engineering Food Science Bindley Bioscience Center Funding: New Investigator Grant, Center for Food Safety Engineering Specific Aims investigate the effectiveness of several fluorescent or nonfluorescent dyes as raman labels to be used as SERS tags synthesize SERS-DNA probes to detect species-specific p DNA sequences of E. coli O7:H7, Campylobacter sp., Staphylococcus aureus, Listeria monocytogenes, and Salmonella sp. as targets develop a one-pot multiplex protocol using optimized SERS DNA probe to simultaneously detect E. coli O7:H7, Campylobacter sp., and Salmonella sp. Probe fabrication Multiplex Detection Schematic Raman tag Au particle ddna dsdna Biotin Streptavidin Magnetic particle S Procedures to fabricate SERS-DNA probes Step : Direct attachment of thiol modified oligos to gold nanoparticles Raman Spectra from DNA Probes Labeled with no glow tags Step 2 Identification of appropriate DNA probes Direct attachment of non-fluorescent Raman tags to gold nanoparticles Step 3 Optimization step

2 ) /4/27 Characterization of the eight SERS-DNA probes Dye-:DNA 66, 46, 264, 24, 94, 73, 89, 26, 998, 83, 72, 696, 66, 646, 494, 46 Dye-2:DNA 487, 34, 293, 2, 92, 4, 69, 2, 999, 99, 93, 862, 79, 73, 69, 6, 93, 7, 24, 489, 4, 43 Dye-3:DNA 79, 8, 47, 49, 378, 334, 234, 86, 98,, 977, 87, 747, 726, 667, 69, 484, 44 Dye-4:DNA 689, 9, 47, 439, 38, 3, 2, 26, 8, 63, 997, 96, 92, 83, 8, 7, 638, 6,, 438 Dye-:DNA 636, 67, 43, 489, 33, 34, 242, 98, 6, 6, 968, 88, 843, 794, 733, 683, 66, 4, 6 Dye-6:DNA 37,48, 42, 39, 27,, 98, 6, 86, 78, 728, 6, 62, 483 Raman Spectra from DNA Probes Labeled with no glow tags Intensity (a.u.) mixture-3 dye-:dna dye-2:dna dye-3:dna dye-4:dna dye-:dna dye-6:dna dye-7:dna dye-8:dna Dye-7:DNA 477, 32, 73, 72, 7, 998, 98, 98, 848, 8, 728, 687, 6, 4, Dye-8:DNA 8, 468, 37, 29, 28, 8, 47, 22, 6, 999, 92, 9, 83, 828, 83, 784, 73, 67, 64,, 4, 498, Characteristic peaks observed in mixture-3 Assignment mixture-2 dye-:dna dye-2:dna dye-3:dna dye-4:dna dye-:dna dye-6:dna dye-7:dna dye-8:dna Highlights 4 dye-2:dna dye-2:dna dye-3:dna dye-8:dna dye-3:dna dye-2:dna dye-:dna dye-8:dna dye-3:dna dye-4:dna dye-7:dna 98 9 dye-:dna 89 8 dye-4:dna 8 26 dye-:dna dye-6:dna 27 * DNA detection using non-fluorescent Raman tags to multiplex up to 8 interactions Surface-Enhanced Raman Scattering Based Nonfluorescent Probe for Multiplex DNA Detection Analytical Chemistry 79(): (accelerated publication) Featured article (June issue of ACS magazine), No glow tags for Raman Spectroscopy 29 dye-2:dna dye-3:dna dye-6:dna 37 Application: Sandwich Structure-based DNA Hybridization Multiplex DNA Hybridization x 3 case-: 4-plex Raman inten nsity (a.u.) x 3 case-4: 3-plex (B) x 3 case-3: 3-plex (A) x 3 3 case-2: 2-plex (B) x 3 case-: 2-plex (A) () Immobilize capturing strand (CS); (2) immobilize 6-mercapto--hexanol to reduce non-specific binding; (3) hybridize target (TS) to CS; (4) hybridize DNA-AuP-RTag probe to overhanging TS; () Ag enhancement. Raman Multiplexers for Alternative Gene Splicing (In review, NanoLetters) 2

3 x3 3 /4/ Sensitivity Analysis at fm x DNA-AuP-RTag x DNA-AuP-RTag-2 TUBE FORMAT: Analysis Steps Select Primers x DNA-AuP-RTag DNA-AuP-RTag Raman Multiplexers for Alternative Gene Splicing (In review, NanoLetters) Probe design and optimization () (2) (3) M M M M (4) Au () Au Au M Table. Primer sequences for the detection of bacterial targets Species Target Gene Primer sequence ( -3 ) Amplicon size E. coli O7:H7 * hlya gene GTAGGGAAGCGAACAGAG 36 bp AAGCTCCGTGTGCCTGAA Campylobacter 6S rrna GGATGACACTTTTCGGAGC 86 bp genus ** CATTGTAGCACGTGTGTC Salmonella sp. * InvA gene TATCGCCACGTTCGGGCAA 27 bp TCGCACCGTCAAAGGAACC Staphylococcus nuclease gene GCGATTGATGGTGATACGGTT 276 bp aureus * CAAGAATTGACGAACTAAAGC Listeria mono- hemolysin CGGAGGTTCCGCAAAAGATG 234 bp cytogenes * CCTCCAGAGTGATCGATGTT () Functionalize magnetic nanoparticles with L-aspartic acid (LAA); (2) immobilize capturing strand (CS) onto LAA modified magnetic nanoparticles; (3) hybridize target strand (TS) to CS; (4) hybridize DNA-AuP-RTag probe to TS and separate the complex by external magnetic field; () recover the DNA-AuP-RTag probe by heating the separated complex. Modified Analysis Steps E. coli: Wec gene Staphy aureus: nuc gene Salmon ent: inva gene 8 2 detection using DNA-AuP-RTag-2 detection using DNA-AuP-RTag- ty Raman intensi

4 /4/27 Deliverables Optimization of SERS effect of dye/gold particle size and excitation wavelength and concentrations with multiplexing 8-plex l system identified d and demonstrated t d (manuscript published in Analytical Chemistry) Fabrication of SERS tagged DNA probes for multiplex DNA detection A 4-plex nonfluorescent DNA detection protocol: in review, Nano Letters Implementation of a one-pot analysis assay for pathogen detection using SERS DNA probes Summary One manuscript Published (ac) One manuscript in Review (nl) One manuscript expected (Dec-Jan) Multiplexing and single basepair mismatch detection One Grant Proposal [Feb 28] Multiplexing (4-8 plex) Quantification SNPs Pattern assessment Biosensor-based Spectroscopy FTIR-based classification P O R T A B L E Biosensor-based Spectroscopy Irudayaraj, Mauer, Debroy, Fratamico SPR Ir S P E C FTIR Irudayaraj, Mauer, Debroy, Fratamico Fingerprints from nucleotides Irudayaraj and coworkers, Anal Chem, 26 Ongoing: Single Molecule Microscopy Quantitative target detection multiple targets in one sample 7 6 Total Internal Reflection Fluorescence Microscopy n: High refractive index LASER Fluorophores n2: Low refractive index θ c Evanescent wave When the concentration of targets is within the dynamic range of the GNrMP system ( -9 to -7 M), multiple targets can be quantitatively measured simultaneously. Real value Target Target2 Target3 nm 2 nm 2 nm Abs, AU AR=2., ΔR= nm AR=4., ΔR= Rnm AR=6., ΔR=2. nm Measured value nm 9.4 nm.86 nm wavelength, nm Single molecule studies: Surface receptor - aptamer interaction Aptamers for Salmonela Typhimurium: Antibody vs Aptamer Single molecule binding experiments nanorod Anchor layer, MUDA Antibody layer, anti-igg Target layer, IgG Use of Multifunctional nanorods Yu and Irudayaraj (Anal Chem, 27; Biophysical J, 27; Langmuir, 27) 4

5 63 nm 74 nm 834 nm Wavelength, nm nm Wavelength, nm 74 nm 834 nm /4/27 Cell-Identity profiling: Back-scattering FESEM images 2 x -3 Acknowledgements E xtinction, AU E x tinc tion, A U Students and Posdocs: Lan Sun, Sandeep Ravindran, Chenxu Yu Yu, Nakshatri, Irudayaraj (Nanoletters, 27) Arun Bhunia s group Paul Robinson, Bartek Rajwa, Silas L. Mike Ladisch Bruce Applegate Chobi Debroy Thank You