Sox9 and NFIA Coordinate a Transcriptional Regulatory

Transcription

1 Neuron, Volume 74 Supplemental Information Sox9 and NFIA Coordinate a Transcriptional Regulatory Cascade during the Initiation of Gliogenesis Peng Kang, Hyun Kyoung Lee, Stacey Glasgow, Meggie Finley, Tataka Donti, Zachary B. Gaber, Brett H. Graham, Aaron E. Foster, Bennett G. Novitch, Richard M. Gronostajski, and Benjamin Deneen Inventory of Supplemental Information: Supplemental Data: Figure S1, related to Figure 1. e92 and e96 activity in chick spinal cord and transcription factor binding site in e123 Figure S2, related to Figure 1. Comparison of Sox9 and NFIA expression in chick Figure S3, related to Figure 2. Sox9 effects FGFR3 and FABP7 expression Figure S4, related to Figure 3. Sox9/NFIA IP in vitro and expression of candidate Sox9/NFIA target genes Figure S5, related to Figure 4. Diagram of Sox9/NFIA sites in Apcdd1, Mmd2, and Zcchc24 promoters Figure S6, related to Figure 4. Apcdd1, Mmd2, and Zccch24 expression in chick Figure S7, related to Figure 5 Apcdd1, Mmd2, Zcchc24 rescue Sox9-EnR in chick Figure S8, related to Figures 6 and 7 Analysis of Mmd2 knockdown phenotypes, Apcdd1 overexpression at E5, and localization with Rac1 Supplemental Table S1, related to Figure 3 List and raw expression values of genes indentified in microarray analysis Supplemental Experimental Procedures: Supplemental Methods Antibody and Primer Information Expression Constructs

2 Figure S1. e92 and e96 activity in chick spinal cord and transcription factor binding site in e123. (A-B, E-F) e92 is active at E4 and E5 in VZ of ventral and dorsal spinal cord. (C- D, G-H) e96 is active at E4 and E5 in ventral spinal cord, in regions outside the VZ that contain differentiating MNs. In addition, e96 has some activity in very dorsal regions of spinal cord. (I) Cross correlation of putative transcription factor binding sites identified by MAPPER and those found to be expressed in embryonic mouse spinal cord (Fu, et al. 2009) are listed and their location in e123 is detailed.

3 Figure S2. Comparison of Sox9 and NFIA expression in chick (A-C) Expression of NFIA in the embryonic chick spinal cord during the E4-E6 developmental interval. These images are from Fig. 1C-E and are used for the sake of comparison. (D-F) Expression of Sox9 in the embryonic chick spinal cord during the E4-E6 developmental interval. (G-I) Co-electroporation of Sox2 and e123 does not promote e123 activity at E4. Arrow in (I) denotes ectopic Sox2, which was untagged and therefore we used Sox2 antibody to detect ectopic Sox2 expression. (J-L) Co-electroporation of Sox9-EnR and e123. Sox9-EnR blocks e123 activity at E6. Ectopic expression of RCAS/Sox9-EnR is denoted by AMV staining. (M) Map of Sox9 sites in e123 and the division of e123 into 3 regions that were each tested for activity in the presence of ectopic Sox9. (N,Q) Region 1 is not activated in the presence of ectopic Sox9 at E4. (O,R) Region 2 is activated in the presence of ectopic Sox9 at E4. (P,S) Regions 3 is not activated in the presence of ectopic Sox9 at E4. (W) FACS quantification, values represent four independent electorporations. Ectopic HA-Sox9 expression was detected via immunostaining with anti-ha. (Q-S) CMV-cherry, internal control for electorporation efficiency. Error bars represent SD.

4 Figure S3. Sox9 effects FGFR3 and FABP7 expression. (A-E) GFP expression of the respective pcig plasmids, from figure 2L-O. Sox9- EnR blocks FGFR3 and FABP7 expression (G,L). Ectopic expression of Sox9 and Sox9-VP16 promote ectopic FGFR3 and FABP7 expression (Sox9-H-M; Sox9-VP16-I,N). Arrows designate ectopic FGFR3- and FABP7-expressing cells. NFIA-shRNAi blocks Sox9-VP16 induction of ectopic FGFR3 and FABP7 (J,O). Ectopic NFIA expression (F) rescues FGFR3 and FABP7 (K,P) in the presence of Sox9-EnR (E).

5 Figure S4. Sox9/NFIA IP in vitro and expression of candidate Sox9/NFIA target genes (A) Sox9 and NFIA co-ip in p19 cells, (B) Sox9 and NFIA co-ip in HEK 293 cells. In these experiments Flag-NFIA and HA-Sox9 were co-transfected into p19 or HEK cells and subjected to IP and IB by the antibodies indicated in the figures. Controls include an input for the IB and a IgG-IP as a negative control. (C-J) In situ hybridization detecting expression of Ndrg2, FGFBP3, GEF4, and Klf9 on embryonic mouse spinal cord sections from E11.5-E12.5. (K) qpcr analysis on candidate genes from mrna extracted from E12.5 Sox9 +/- or Sox9- /- and E12.5 NFIA+/- or NFIA-/- embryos. For the qpcr experiments, values are the average from three embryos from each genotype from two different litters.

6 Figure S5. Diagram of Sox9/NFIA sites in Apcdd1, Mmd2, and Zcchc24 promoters. (A) Apcdd1 promoter diagram and Sox9/NFIA binding sites. (B) Alignment of Sox9 and NFIA sites within the Apcdd1 promoter and their consensus sites. (C) Mmd2 promoter diagram and Sox9/NFIA binding sites. (D) Alignment of Sox9 and NFIA sites within the Mmd2 promoter and their consensus sites. (E) Zcchc24 promoter diagram and Sox9/NFIA binding sites. (F) Alignment of Sox9 and NFIA sites within the Zcchc24 promoter and their consensus sites.

7 Figure S6. Apcdd1, Mmd2, and Zccch24 expression in chick. (A-B) Expression of Apcdd1 in chick spinal cord at E5-E6; note that, like mouse, Apcdd1 is induced in chick one day after NFIA. (C-D) Reduced Apcdd1 expression when NFIA is knocked down via shrnai and ectopic induction of Apcdd1 in the presence of Sox9-VP16. (E-F) Expression of Zcchc24 in chick spinal cord at E5-E6; note that, like mouse, Zcchc24 is induced in chick one day after NFIA. (G-H) Reduced Zcchc24 expression when NFIA is knocked down via shrnai and ectopic induction of Zcchc24 in the presence of Sox9-VP16 (I-J). Expression of Mmd2 in chick spinal cord at E5-E6; note that, like mouse, Mmd2 is induced in chick one day after NFIA. (K-L) Reduced Zcchc24 expression when NFIA is knocked down via shrnai and ectopic induction of Zcchc24 in the presence of Sox9-VP16.

8 Figure S7. Apcdd1, Mmd2, Zcchc24 rescue Sox9-EnR in chick (A-E) Sox9-EnR + RCAS control results in loss of glial markers in the embryonic chick at E6, GLAST (C), FGFR3 (D), and Olig2 (E). Ep indicates electroporated side of embryo and Con indicates the control side. (F-J) Ectopic expression of RCAS-Mmd2 restores GLAST (H,Z) and FGFR3 (I,AA), and Olig2 (J,BB). (K-O) Ectopic expression of RCAS-Zcchc24 restores GLAST (M,Z) and FGFR3 (N,AA), but not Olig2 (O,BB). (P-Y) Ectopic expression of RCAS-Apcdd1 rescues GLAST and FGFR3 (R-S;Z-AA), but not Olig2 (T,BB). Ectopic expression of RCAS- Apcdd1-L9R does not rescue the NFIA-shRNAi (U-BB). Quantification in Z-BB was performed by comparing the levels of ectopic expression with the Ep- and Con- values of a given marker on a series of adjacent sections. The Ep/Con ratio is the rescue index ; comparison of levels of ectopic expression with the rescue index was performed by linear regression analysis. The values in Z-BB are derived from five embryos and six adjacent sections series per embryo.

9 Figure S8. Analysis of Mmd2 knockdown phenotypes, Apcdd1 overexpression at E5, and localization with Rac1. (A-E) shrnai knockdown of Mmd2 (A-B), does not result in increased caspase 3 staining (C), but does result in decreased expression of Pax6 (D). Expression of neuronal marker, NeuN, is not effected by Mmd2-shRNAi (E). (F-J) Mutant Mmd2-shRNAi does not effect expression of Pax6 (I) or NeuN (J). Capsase 3 staining is also not effected (H). (M-V) Overexpression of Apcdd1 (M-Q) or Apcdd1-L9R (R-V) does not effect the expression of GLAST, FGFR3, FABP7, or PCNA at E5. (W-BB) Rac1 co-localizes with Apcdd1 at membrane (W-Y, arrow), while Apcdd1-L9R co-localization is increased in the cytosol (Z-BB, unfilled arrows). Error bars represent SD.

10 Table S1. List and raw expression values of genes indentified in microarray analysis List of genes displayed in graph shown in figure 3C. Intensity values are extrapolated from Rosetta Resolver Analysis (see methods and Hochstim, et al. 2008). Briefly, Olig2-GFP cells were FACS isolated over the E9.5-E12.5 interval, and mrna was extracted and used as the substrate for probes for Affymetrix microarray experiments. Please see Hochstim, et al, 2008, Deneen, et al, 2006, and Mukoyama, et al for more details and for FACS protocol. Genes highlighted in red are validated via in situ in Figures S3 and S4.

11 Supplemental Information ChIP and Immunoprecipitation information Harvested cells were fixed with 1% formaldehyde for 10 minutes. Cross-linked chromatin was then sheared by sonication and cleared by centrifugation. The samples were pre-cleared with protein G beads and immunoprecipitated using specific antibodies or control IgG (Santa Cruz Biotechnology). Immunoprecipitated complexes were isolated, the cross-links reversed, and proteins digested with proteinase K. The DNA was purified and PCR was preformed using region specific primers. Spinal cords were homogenized and the resultant cell lysates were subject to immunoprecipitation using a specific antibody or IgG control and protein G agarose beads. for two hours to overnight, followed by multiple washing steps with lysis buffer supplemented with 300 mm NaCl. The bound proteins were eluted by heating the beads in SDS gel-loading buffer (50 mm Tris-Cl ph6.8, 100 mm DTT, 2% SDS, 10% glycerol, 0.1% bromophenol blue) at 95ºC for 5 minutes. Eluted proteins were resolved by SDS-PAGE and visualized by western blotting. IP antibodies: anti-flag (Sigma, M2-Flag) and anti-sox9 (Millipore); Western antibodies: anti-nfia (Abcam), anti-sox9, anti-ha (rat-roche) and anti-flag. In situ and Immunostaining information DNA used to generate in situ probes were ordered from Open Biosystems: Apcdd1 (# ), Zcchc24 (# ), Hod-1 (#720084), mmd2 (# ), Ndrg2 (#678698), Fgfbp3 (# ), Gef4 (# ), and Klf9 (#891062). Identification of NFI and Sox9 sites using MAPPER Briefly, 25kb upstream of each candidate genes transcriptional start site was entered into the MAPPER search engine, which uses the TRANSFAC and JASPAR models to predict transcription factor binding sites. Putative NFIA and Sox9 sites within a given promoter sequence that scored >3 and within <120 base pairs of eachother were considered for further evaluation. Quantification of Apcdd1, Mmd2, and Zcchc24 Rescue of NFIA-shRNAi Quantification of candidate gene rescue described in figure 5 was performed by analysis of sub-saturating in situ images using MCID software. The expression values for the Ep side and the Con side of the embryo were used to generate an Ep/Con ratio or a rescue index. Ectopic expression of a given candidate gene was also measured using the MCID software and relative values were generated by comparing the expression values of all 80 section sets, with the sections having the highest value being assigned a value of 1. The rescue index and the relative ectopic expression values were plotted and subjected to linear regression analysis to generate the graphs in figure 5Z-BB. Quantification in 5WW-YY was performed by counting the number of migrating GLAST, FGFR3, or Olig2 cells in each condition and comparing the number found on the Ep side with the Con side. This comparison resulted in the relative values presented.

12 The following antibodies, were used: colig2 (rabbit polyclonal), hnfia (rabbit polyclonal), AMV (mouse monoclonal-igg1, DSHB), msox9 (mouse monoclonal- IgG1, Millipore), HA (rat polyclonal/roche; Covance), Flag (Sigma), F-actin (Molecular Probes), NeuN (Millipore), Caspase 3 (R&D), and anti-brdu (abcam). GFP was detected using native fluorescence. All imaging was performed on a Zeiss Axio Imager M2 with Apotome. Primer Sequences: prt-pcr qrt-pcr Forward Reverse Apccd1 CGCCTGGAGGGCTTTCAAG GGACCCGACCTTACTTCACAG Gef4 ACGCCGTGCTGATATTCCTA GCTTCAGCACACACCACACT FGFBP3 GGCCCTTCCACCTCTTCTA CCTCGGAGGACTCATGCC Hod1 ACCAGCATCCGCTGCTTC AGGATCTCCACCTGGTCCTC Klf9 CAGTGGCTGTGGGAAAGTCT CGCGAGAACTTTTTAAGGCA Mmd2 CACAAGAGGTACCAGCCCAC ATGGTCTCCCAGTCGTCATC Ndrg2 CAGCTTGCTGACATGATTCC GGGTGGTTCAGAGCATATCG Zcchc24 CTCCTCCGAACTACCTGTGC GTTGATGTGGCACTTGATGC ChIP Assays Mouse ChIP Primers e123mu2 (Sox9 site) Forward 5 -GCATTTAGCACAGACCCTAACA Reverse 5 -GGCTCCTATGATCCAGAGAACT Apccd1 (NFIA/Sox9 site) Forward 5 -ATTAAAGAAAGGCAGGACAGGA Reverse 5 -ATGCCTCCAAAATATCCAGCTA Apccd1 (upstream site) Forward 5 -GGTTCATGATTCTGCACTCTGT Reverse 5 -AGAGACAACCCTGTGAAGACAA Zcchc24 (NFIA/Sox9 site) Forward 5 -CAGAGAAAGTTGGGCAGGAA Reverse 5 -CCGCCTTCTTTCTTGTCTTG Zcchc24 (upstream site) Forward 5 -GGGGTTGTGGGTAGAAGTGA Reverse 5 -TGTGTACCAGTGTGGGAGGA Mouse ChIP Primers( cont) e123mu2 (upstream site) Forward 5 -GCTGTGCCTGAACATCAGAA-3 Reverse 5 -TTAGTTCAGTGATGGGGGTGT-3 Mmd2 (NFIA/Sox9 site) Forward 5 -GCGTGACATCTTTGGAGGAC-3 Reverse 5 -GGAGACAGGAACTCTGGCATT-3 Mmd2 (upstream site) Forward 5 -AAATCCCGAGCAGATGGTG-3 Reverse 5 -CTGAGGGTGCCACCTAGTTC-3

13 Chick ChIP Primers e123mu2 (NFIA/Sox9 site) Forward 5 - ATCTGGAGGAGGTTTCACATTT Reverse 5 -CTTCTCCATAGAGGACAGCACT e123mu2 (upstream site) Forward 5 -CAGAAAAATCATTGAGCTGAGG Reverse 5 -GCACACATCTTAAACCACCATT Expression Constructs Figure 1/S1 Enhancer constructs: e92-gfp, e96-gfp, e102-gfp, e119-gfp, e123-gfp, e132-gfp. Mutant enhancers: e123/region1-gfp, e123/region2-gfp, e123/region3-gfp, e123-dmu2-gfp RCAS/Sox9, pcs+/cherry Figure 2/S2 pcig/sox9-enr, pcig/sox9, pcig/sox9-vp16, RCAS/HA-NFIA, RCAS/NFIAshRNAi pcs+/sox2, RCAS/Sox9-EnR Figure 4/S4 Apcdd1-Luc, Mmd2-Luc, Zcchc24-Luc, pcs+/sox9-f12l, pcs+/sox9-a76e pcs+/flag-nfia, pcs+/ha-sox9 Figure 5 RCAS/Mmd2, RCAS/Apcdd1, RCAS/Zcchc24, RCAS/Apcdd1-L9R Figure 6 RCAS/Mmd2-shRNAi, RCAS/Mmd2-shRNAi-mut, pcs+/myc-mmd2 Figure 7 pcs+/flag-apcdd1, pcs+/flag-apcdd1-l9r, pcs+/cdc42-gfp, pcs+/rac1- GFP, pcs+/rho-gfp