Supplemental Figure 1

Transcription

1 Supplemental Figure 1

2 Supplemental Figure 1 (previous page): Heavy chain gene content of ARS/Igh66 transgenic lines. A. Tail DNA from the indicated transgenic lines was amplified for the indicated gene segments. The primers, and restriction enzyme digests that utilize polymorphisms between the transgene and endogenous genes, for most of these PCRs have been described (16). I 2a 1: GCTGATGTACCTACCTGAGAGAG (I 2a, D ) and CCTATAGCTACTGTGCCTGAATCC ( 1, complement to D ), annealing at 67 o C, 35 cycles. I 1 2a: TCAAGAGCTCAGGACACAAGACC (I 1, D ) and CCACCTACAGCTCTACTGCCTTG ( 2a, complement to D ) annealing at 67 o C, 30 cycles. HS4: AAGCTTGGTATGATGCAGAG (AF ) GTTTCTGGGTGTCTCTGTGTC (complement to ), annealing at 60 o C, 35 cycles. PCR products were digested with HpaII. The additional band for 820 DNA in the HS3A image is due to a 34 bp insertion of a loxp site, not found in the lines with the promoter/i swap. B. Southern hybridization to S 1 or S 1 probes to SstI-digested transgenic tail DNA. Each of the sixteen images shown here were from a single experiment. Grey lines indicate that the order of some lanes have been changed from the original image.

3 Supplemental Figure 2: Allelic exclusion by ARS/Igh66 heavy chain transgenes. All ARS/Igh66 heavy chain transgenes express the transgenic IgM a and exclude the endogenous IgM b genes. A small percent of splenic B cells express both the transgene and the endogenous genes. In some samples (line 820 for example) an anomaly in the autocompensation by the FACS Canto is observed as a slight diagonal tilt of the IgM a positive B cells. All transgenic mice have large numbers of B220+/IgD+ B cells.

4 Supplemental Figure 3: Transgenic 2b expression. cdna was prepared from B cells from the indicated transgenic lines, cultured with LPS or LPS+TGF. Total germline 2b transcripts were amplified by PCR and digested with HpaII to distinguish transgenic and endogenous transcripts (top panel). The cdna was also balanced for I C 2b expression (bottom panel). Samples, at the same concentrations as used for I C 2b were then tested for transgenic VDJC 2b expression (middle panel). Line 78 did not express transgenic germline transcripts for the 2b, 3, or genes, and switched poorly to these three genes.

5 Supplemental Figure 4

6 Supplemental Figure 4 (on previous page). A. VDJCμ mrna expression compared to HPRT expression for various combinations of activators and cytokines transgenic lines 46 and 79. The ratio of the 1X VDJCμ band density to the 5X HPRT band density is shown below each VDJCμ 1X lane. Since the line 46 CD40L samples were saturated at 25X and, perhaps 5X, we completed 1X samples and show the ratio for 1X VDJCμ band density to the 1X HPRT band density. There is variation in the expression of VDJCμ mrna relative to HPRT expression. This variation could be due to the amount of CSR, reducing the number of VDJCμ genes available for transcription, but variations in B cell cultures and variations in the RT-PCR itself are also likely large contributors. Relative to HPRT, LPS is a better inducer of transgenic VDJCμ expression than is CD40L. B. Quantitation of relative VDJC 2a expression. cdnas, derived from the indicated B cell cultures, were tested at three (or four) five-fold dilutions. The ratio of VDJC 2a band density to VDJCμ band density for each dilution is shown below the lane. The eight ratios for the 1:5 and 1:25 lanes were averaged for the two transgenic lines with the same construct, and presented in Fig. 6A.

7 Supplemental Figure 5: Sequence at a transgene:transgene junction in line 79. Line 79 genomic DNA was digested with MboI (recognizes GATC) and ligated to form circles. Two primers (AAGCCAAACTACCCTGGTGCC, complementary to AF and GCAGTGAGCGCAACGCAATTAATG, complementary to pbelobac from ), which prime going away from each other, were used to amplify the unknown sequences next to the 3 end of the transgene around the circle formed by ligation. The sequence of the PCR product was used to deduce the structure of the transgene to transgene junction. The structure of the transgene to transgene tail to tail joining is shown as a thick, grey line (transgene vector sequence at its 3 end), a thick black line (heavy chain gene sequence at the insertion site), and thin, black lines (adjacent sequences, assuming no other rearrangements). The arrow above the C 1S 1I 1 indicates the transcriptional direction of the heavy chain genes. The PCR product used to deduce this structure includes sequences from the 3 end of the transgene (complementary to AF ). These sequences, which are ligated to the 2b hinge sequence at the MboI site, are not presented here.

8 Supplemental Table 1: Individual data contributing to Figure 6 Transgenic VDJC 2a/ Tg IgG2a line VDJC * C57BL/ , , 0.36 WT (820) 0.2, 0.025, 0.033, , 32.5 WT (336) 0.22, 0.07, 0.36, , 8.2 Swap (46) 0.48, 0.13, 0.8, , 49 Swap (55) 55, 33 Swap (78) 246.5, 240 Swap (79) 0.13, 0.13, 0.19, , 189 Transgenic VDJC 1/ line VDJC Tg IgG1 C57BL/ , 0.32 WT (820) , 58.4 WT (336) 19, 5.1 Swap (46) , Swap (55) 1.3, , Swap (78) , Swap (79) 2.6, , 0.14 Transgenic VDJC 2a/VDJC Line LPS+IL-4/ LPS+IFN- / CD40L+IL-4/ CD40L+IFN- / LPS LPS CD40L CD40L WT (820) WT (336) Swap (46) Swap (55) Swap (78) Swap (79)

9 Tg IgG2a LPS+IL-4/ LPS+IFN- / CD40L+IL-4/ CD40L+IFN- / LPS LPS CD40L CD40L C57BL/ WT (820) WT (336) Swap (46) Swap (55) Swap (78) Swap (79) NTg (C57BL/6) WT (820) WT (336) 1.22 Transgenic 1/total 1# LPS+IL-4 LPS+IFN- CD40L+IL-4 CD40L+IFN- Swap (46) 1.19 Swap (55) Swap (78) 0.09 Swap (79) / 2a** LPS+IL-4 LPS+IFN- CD40L+IL-4 CD40L+IFN- WT (336) 0.08 Swap (46) Swap (55) Swap (79) *These are the ratios from Supplemental Figure 4 that are the RNA data in Figure 6A.

10 These are the Flag+ IgG2a values (absorbance units per ml) from Figure 5, for cultures with IFN- (C57BL/6 and wild type transgenes) or with IL-4 (promoter/i swap transgenes). These are the secreted IgG2a data in Figure 6A. These values are calculated from the data in Figure 4A. The values presented represent an overestimation of the relative 1 expression level, as they assume a linear dose-response, whereas the response in this RT-PCR is proportional to the log of the dose. These are the RNA data in Figure 6B. These are the amounts of transgenic IgG1 ( g per ml) from Figure 5, for cultures with IL-4 (C57BL/6 and wild type transgenes) or with IFN- (promoter/i swap transgenes). Negative values indicate samples that were slightly less than the blank control. These are the secreted IgG1 data in Figure 6B. Appropriate bands from the gels in Figure 3 were quantified by ImageQuant software. The values reported are the VDJC 2a band intensity/vdjc band intensity for LPS+IL-4 divided by the VDJC 2a band intensity/vdjc band intensity for LPS, etc. These are the RNA data in Figure 6C. These are the ratios of Flag+ IgG2a value in cytokine+activator divided by the Flag+ IgG2a value in activator alone. The ratios for C57BL/6 cultures are from IgG2c values (absorbance units per ml). These are the secreted IgG2a data in Figure 6C. #These values are calculated from the data in Figure 4B. The transgenic 1 is from the 121 bp band, and the total 1 is from the 90 bp band. Accounting for the number of A residues that could be radiolabeled in the two strands of these fragments, if all of the 1 mrna expression is from the transgene, the ratio should be 1.3. These data are summarized in Figure 6D.

11 **These values are calculated from the data in Figure 4C. The 1 value is the sum of the density of the 112 bp and 90 bp fragments; the 2a value is the density of the 202 bp fragment. These data are summarized in Figure 6E.