SUPPLEMENTARY INFORMATION

Transcription

1 doi: /nature11149 Figure S1 FACS analysis of cellular- and component-derived background fluorescence that is unrelated to circuit behavior. FACS-derived raw data of several OFF states scoring cellular autofluorescence of HEK-293 cells (untransfected cells) (a), basal expression of d2eyfp in the absence of transactivator (b), transcriptional repression in the presence of the corresponding transactivator and trigger molecule (c) and translationally repressed states of the reporter in the presence of the corresponding repressor protein (d). In comparison to the corresponding 2 1

2 RESEARCH SUPPLEMENTARY INFORMATION transactivator-mediated reporter gene expression (e) and constitutive expression of the yellow and red fluorescent proteins (f), we defined a threshold of 10 4 FU that reliably discriminates between circuit-transgenic cells with ON and OFF fluorescence profiles. Transfected components, input signal and the ON or OFF status of the reporter gene is shown above each histogram. The overall experimental set-up was identical to the one used for the analysis of all biocomputers (see Fig. S8). Figure S2 Influence of input molecules on constitutive d2eyfp (a) and dsred (b) expression in HEK-293 cells. HEK-293 were transfected with the corresponding reporter plasmid and incubated with standard concentrations (2.7µM erythromycin; 50µM phloretin) of different combinations of input molecules before the cells were analysed by fluorescence microscopy and flow cytometry. The overall experimental set-up was identical to the one used for the analysis of all biocomputers (see Fig. S8). Figure S3 Genetic switchboards, fluorescence micrographs and flow cytometric analysis of designer circuits performing NOT gate logics. Plug-&-play assembly of transcription and translation control components in HEK-293 results in distinct NOT gate expression logic (a, b). They also serve as functional controls for the N-IMPLY gates. (See Table S1, Fig. 1 and Fig. 2 for detailed description of genetic components). 2

3 RESEARCH Figure S4 Genetic switchboards, fluorescence micrographs and flow cytometric analysis of XOR circuits characterized by decomposition. To characterize the impact of each circuit component on XOR computation individual modules were removed (red cross) and the remaining circuit behavior analysed by fluorescence microscopy and flow cytometry using the same experimental set-up (a-f) (see Fig. S8). Interestingly, decomposed XOR circuits show processing capacities of classic logic gates. (See Table S1, Fig. 1 and Fig. 3 for detailed description of genetic components). 3

4 RESEARCH SUPPLEMENTARY INFORMATION Figure S5 Genetic switchboards, fluorescence micrographs and flow cytometric analysis of the N- IMPLY gate (a), AND gate (c) and their corresponding control circuits (b, d). (See Table S1 for detailed description of genetic components). 4

5 RESEARCH Figure S6 Plate reader-based fluorescence profiles of entire cell population transfected with halfsubtractor (a) and half-adder (b) components. Although analysis of the entire circuit-transfected population also includes component leakiness unrelated to circuit behavior the mean OFF-ON induction ratios reached 13 (d2eyfp) and 13 (dsred) for the half-subtractor and 13 (d2eyfp) and 4 (dsred) for the half-adder. The overall experimental set-up was identical to the one used for the analysis of all biocomputers (see Fig. S8). Figure S7 Plate reader-based dynamic fluorescence profiles of entire cell populations transfected with half-subtractor (a) and half-adder (b) components (see also movies S1 and S2). 5

6 RESEARCH SUPPLEMENTARY INFORMATION Figure S8 Experimental schedule for standard characterization of the biocomputers. Figure S9 Alignment bead-based in-sample control of FACS analysis. All circuit samples were spiked with AlignFlow TM beads which could be measured with the same filter sets as used for circuit profiling. In-sample controls ensure consistence of flow cytometry settings ( /15 and /30) among different circuits and independent experiments (experiments 1-3). 6

7 RESEARCH 7

8 RESEARCH SUPPLEMENTARY INFORMATION 8

9 RESEARCH Figure S10 Raw flow cytometry data showing input-triggered single-cell behavior of all circuits. Histograms show the yellow and red fluorescence threshold (>10 4 arbitrary FU) that is used for the computational analysis. The data sets show input (no input, erythromycin, phloretin, erythromycin and phloretin) -dependent variations in yellow/red-fluorescent single-cell distributions according to the circuits logic behavior: A ANDNOT B (a), NOT B (b), B ANDNOT A (c), NOT A (d), A ANDNOT B red (e), NOT B red (f), AND (g), AND control (h), XOR (i), B ANDNOT A (XOR w/o psa83) (j), NOT A (XOR w/o pmg11) (k), NAND (XOR w/o psa91) (l), NOT B (XOR w/o pww35) (m), A ANDNOT B (XOR w/o psa89) (n), NAND (XOR w/o psa95) (o), halfsubtractor (p), half-adder (q), constitutive d2eyfp (r), constitutive dsred (s). 9

10 RESEARCH SUPPLEMENTARY INFORMATION Figure S11 Correlation of the transfected amount of circuit-encoding plasmids and the percentage of cells above the threshold of 10 4 FU. HEK-293 were transfected with different amounts of A ANDNOT B-encoding plasmids (always adjusted to 4µg using the filler plasmids pcoladuet TM - 1). Fluorescence microscopic (a) and flow cytometric (b) analyses showed a direct correlation between the transfected amount of A ANDNOT B-encoding plasmids and the percentage of circuittransfected cells above the threshold of 10 4 FU. Remarkably, significant biocomputing activities can already be seen when using a minimum amount of circuit-encoding plasmids (0.275 µg, 0.125x), and the number of cells above the 10 4 FU threshold can not be significantly increased when transfecting more than 2.2 µg (1x). (1x [blue] refers to A ANDNOT B transfection mixture shown in Table S2). Collectively, this data indicates that the efficiency of transient multicomponent transfections of mammalian cells reaches an apparent limit which may need to be overcome for future clinical applications of biocomputers. 10

11 RESEARCH Extended Figure Legends Extended Figure Legend of Figure 1 Genetic switchboard of the basic biocomputer circuitry. Two different input molecules (Input 1/2; e.g., the antibiotic erythromycin or the apple metabolite phloretin) inactivate specific transcription factors (TF 1/2 ; e.g., the macrolidedependent transactivator [ET1] or the phloretin-dependent transactivator [TtgA 1 ]) which otherwise bind and induce cognate promoters (P TF1/2 ; e.g., macrolide-responsive promoter [P ETR2 ] or phloretin-responsive promoter [P TtgR1 ]) that drive transcription of different expression units either encoding an RNA-binding protein (box ligand; e.g., phage MS2 coat protein [MS2] or the archeal ribosomal binding protein [L7Ae] or containing an RNA target unit in the 5 UTR (box; e.g., MS2- specific MS2 box or L7Ae-specific C/D box ) and a reporter gene (e.g., destabilized variants of enhanced yellow fluorescent protein [d2eyfp] or red-fluorescent protein [dsred (dsred-express- DR)]). Both expression units are functionally interconnected via the box ligand whose interaction with its target box inhibits translation of the reporter gene. Sequential wiring of the input module (blue) to the processing unit providing bitwise integrations of transcription and translation control activities (green) produces a digital (ON or OFF) cellular output (red). Extended Figure Legend of Figure 2 Design and processing performance of synthetic N-IMPLY gates in human cells. (a) A ANDNOT B logic gate. Constitutive expression of the phloretin-dependent transactivator (TtgA 1 ) mediates phloretin-repressible induction of the phloretin-responsive promoter (P TtgR1 ) which produces a transcript encoding the enhanced yellow fluorescent protein (d2eyfp) and containing an RNA target motif (C/D box ) in the 5 UTR. At the same time, constitutive expression of the macrolide-dependent transactivator (ET1) mediates erythromycin-repressible induction of the erythromycin-responsive promoter (P ETR2 ) which triggers expression of the C/D box -binding protein L7Ae. Combining the two input signals according to the truth table programs transfected HEK-293 cells to produce d2eyfp exclusively in the presence of erythromycin and not phloretin as shown by fluorescence microscopy and FACS analysis. (b) B ANDNOT A logic gate. Constitutive expression of TtgA 1 mediates phloretin-repressible induction of P TgR1 which triggers expression of the MS2 box -binding protein MS2. At the same time, constitutive expression of ET1 mediates erythromycin-repressible induction of P ETR2 which produces a transcript encoding d2eyfp and containing an RNA target motif (MS2 box ) in the 5 UTR. Combining the two input signals according to the truth table programs transfected HEK- 293 cells to produce d2eyfp exclusively in the presence of phloretin and not erythromycin as shown by fluorescence microscopy and FACS analysis. Flow cytometry data represent the mean ± standard deviation of three independent experiments performed in triplicates. For each data set, a representative fluorescence micrograph is shown. b.t., below threshold; weighted fluorescence % of cells >10 4 FU multiplied with the median fluorescence of cells >10 4. Extended Figure Legend of Figure 3 Design and computation characteristics of the synthetic mammalian XOR processor. (a) Truth tables illustrating how the combination of two different N-IMPLY gates results in XOR processing, characterized by switching the output ON if exactly one of the input signals is present. (b) Genetic switchboard of the XOR circuitry. Constitutive expression of phloretin-dependent transactivator (TtgA 1 ) mediates phloretinrepressible induction of two phloretin-responsive promoters (P TtgR1 ) which produce two independent transcripts, one encoding the enhanced yellow fluorescent protein (d2eyfp) and containing an RNA target motif (C/D box ) in the 5 UTR and one encoding the MS2 box -binding protein MS2. At the same time, constitutive expression of the macrolide-dependent transactivator (ET1) mediates erythromycin-repressible induction of two erythromycin-responsive promoters (P ETR2 ) which produce two independent transcripts, one encoding d2eyfp and containing an RNA target motif (MS2 box ) in the 5 UTR and one encoding the C/D box -binding protein L7Ae. The RNAbox-binding proteins MS2 and L7Ae mutually inhibit translation of d2eyfp-encoding transcripts by binding to their specific target mrna structures MS2 box and C/D box, respectively. (c) Combining the two input signals according to the truth table programs transfected HEK-293 cells to produce d2eyfp following XOR computation logic: Reporter gene expression is switched ON exclusively in the presence of either erythromycin or phloretin as shown by fluorescence microscopy and FACS analysis. Flow cytometry data represent the mean ± standard deviation of

12 RESEARCH SUPPLEMENTARY INFORMATION three independent experiments performed in triplicates. For each data set, a representative fluorescence micrograph is shown. b.t., below threshold; weighted fluorescence % of cells >10 4 FU multiplied with the median fluorescence of cells >10 4. Extended Figure Legend of Figure 4 Input-programmable half-subtractor and half-adder operations in single cells. (a) Electronic circuit diagram illustrating the design of increasingly complex biocomputer circuits by combinatorial assembly of individual logic gates. The combination of two N-IMPLY gates results in an XOR gate. Further assembly of this XOR gate with either an additional N-IMPLY gate or an AND gate produces half-subtractor and half-adder circuits, respectively. Transfection of functional circuit components into single mammalian cells enables fundamental input-programmable arithmetic operations producing distinct yellow- and redfluorescent protein outputs. (b) Genetic switchboard of the programmable single-cell halfsubtractor. Constitutive expression of the phloretin-dependent transactivator (TtgA 1 ) mediates phloretin-repressible induction of three phloretin-responsive promoters (P TtgR1 ) which produce three independent transcripts: (i) one encoding the enhanced yellow fluorescent protein (d2eyfp) and containing an RNA target motif (C/D box ) in the 5 UTR, (ii) a second one encoding the MS2 box - binding protein MS2, and (iii) a third one encoding the red fluorescent protein (dsred) and containing a C/D box in the 5 UTR. At the same time, constitutive expression of the macrolidedependent transactivator (ET1) mediates erythromycin-repressible induction of two erythromycinresponsive promoters (P ETR2 ) which produce two independent transcripts, one encoding d2eyfp and containing an RNA target motif (MS2 box ) in the 5 UTR and one encoding the C/D box -binding protein L7Ae. The RNAbox-binding proteins MS2 and L7Ae mutually inhibit translation of d2eyfp-encoding transcripts by binding to their specific target mrna structures MS2 box and C/D box, respectively. L7Ae also prevents translation of dsred-encoding transcripts. (c) Fluorescence micrographs and single-cell FACS analysis of the combinatorial half-subtractor biocomputer performing arithmetic subtraction of the erythromycin input from the phloretin input by calculating the difference D (d2eyfp) and borrow C (dsred) in single human cells. Combining the two input signals according to the truth table programs transfected HEK-293 cells to execute digital halfsubtractor expression logic: reporter gene expression is shut down in the presence or absence of both input molecules, exclusive phloretin-triggered d2eyfp expression and d2eyfp as well as dsred production in the presence of erythromycin. Since the half-subtractor calculations take place in individual cells most of them co-express yellow as well as red fluorescence proteins in the presence of erythromycin. (d) Genetic switchboard of the programmable single-cell half-adder. Constitutive expression of the phloretin-dependent transactivator (TtgA 1 ) mediates phloretinrepressible induction of two different phloretin-responsive promoters (P TtgR1 ) which produce two independent transcripts: (i) one encoding the enhanced yellow fluorescent protein (d2eyfp) and containing a C/D box in its 5 UTR and (ii) a second one encoding the MS2 box -binding protein MS2. At the same time, constitutive expression of the macrolide-dependent transactivator (ET1) mediates erythromycin-repressible induction of two different erythromycin-responsive promoters (P ETR2 ) which produce two independent transcripts: (i) one encoding d2eyfp and containing a MS2 box in its 5 UTR and (ii) a second one encoding the C/D box -binding protein L7Ae. The RNAbox-binding proteins MS2 and L7Ae mutually inhibit translation of d2eyfp-encoding transcripts by binding to their specific target mrna structures MS2 box and C/D box, respectively. In addition, MS2 and L7Ae also prevent translation of dsred-encoding transcripts harbouring both MS2 box as well as C/D box RNA motifs in its 5 UTR. (e) Fluorescence micrographs and single-cell FACS analysis of the combinatorial half-adder biocomputer performing arithmetic addition of the erythromycin input and the phloretin input by calculating the sum S (d2eyfp) and carry C (dsred) in single human cells. Combining the two input signals according to the truth table programs transfected HEK-293 cells to execute digital half-adder expression logic: reporter gene expression is shut down in the absence of both input molecules, exclusive phloretin-triggered d2eyfp expression and d2eyfp as well as dsred production in the presence of phloretin and erythromycin. Flow cytometry data represent the mean ± standard deviation of three independent experiments performed in triplicates. For each data set, one representative fluorescence microscope image is shown. b.t., below threshold; weighted fluorescence % of cells >10 4 FU multiplied with the median fluorescence of cells >

13 RESEARCH Table S1. Plasmids used and designed in this study Plasmid Description and Cloning Strategy Reference or Source pcdna3.1 Mammalian expression vector. Life Technologies, Carlsbad, CA pegfp-n1 Mammalian EGFP expression vector. Clontech, Mountain View, CA pd2eyfp Mammalian d2eyfp expression vector. Clontech, Mountain View, CA pdsred-express-dr Mammalian dsred-express-dr expression vector. Clontech, Mountain View, CA pmg10 Vector encoding a P TtgR1 -driven SEAP expression unit (P TtgR1 -SEAP-pA). Gitzinger et al., pmg11 Vector for constitutive expression of TtgA 1 (P SV40 -TtgA 1 -pa). Gitzinger et al., pms2-yfp Vector encoding constitutive expression of MS2 (P PolII -MS2-YFP-pA). (Addgene Plasmid (Fusco et al., 2003) No ). pww35 Vector for constitutive expression of ET1 (P SV40 -ET1-pA). Weber et al., pww37 Vector encoding a P ETR2 -driven SEAP expression unit (P ETR2 -SEAP-pA). Weber et al., psa62 Vector encoding constitutive expression of EGFP (P hcmv -EGFP-pA). EGFP was excised from pegfp-n1 with BamHI/XbaI and cloned into pcdna3.1 (BamHI/XbaI). This work psa72 Vector encoding constitutive expression of EGFP containing a C/D box in the 5 UTR This work (P hcmv -C/D box -EGFP-pA). The C/D box was inserted by PCR with oligonucleotides osa157 (5 -cctagatctgggcgtgatccgaaaggtgacccggatccaccggtcgccaccatggtgagcaa GGGCGAGGAG-3 ) and osa159 (5 Phos-TGGGTCTCCCTATAGTGAGTC-3 ) using psa62 as template. psa73 Vector encoding constitutive expression of EGFP and containing a MS2 box in the 5 UTR- This work (P hcmv -MS2 box -EGFP-pA). MS2 box was inserted by PCR with oligonucleotides osa158 (5 -cctagatctccgtgaggatcacccacggggatccaccggtcgccaccatggtgagcaagggcgag GAG-3 ) and osa159 (5 Phos-TGGGTCTCCCTATAGTGAGTC-3 ) using psa62 as template. psa74 Vector encoding constitutive expression of MS2 (P hcmv -MS2-pA). MS2 was PCRamplified This work from pms2-yfp using oligonucleotides osa173 (5 -tgttactggcgctagccacca TGGCTTCTAACTTTACTCAG-3 ) and osa174 (5 -tggctagaattcctcgagtcacgcgtaga TGCCGGAGTTTG-3 ), restricted with NheI/XhoI and ligated into psa62 (NheI/XhoI). psa75 Vector encoding constitutive expression of L7Ae (P hcmv -L7Ae-pA). L7Ae was This work synthesized (GeneArt, Life Technologies) and PCR-amplified using oligonucleotides osa163 (5 -tgttactggcgctagccaccatgtacgtgcgcttcgagg-3 ) and osa127 (5 - TGGCTAGAATTCCTCGAGTC-3 ), restricted with NheI/XhoI and ligated into psa62 (NheI/XhoI). psa78 Vector encoding a P TtgR1 -driven EGFP expression unit containing a C/D box in the 5 UTR (P TtgR1 -C/D box -EGFP-pA). P TtgR1 was excised from pmg10 (SspI/EcoRI) and ligated into This work PCR-amplified (osa160, 5 -tgttactggcgaattcacccactgcttactggcttatcg-3 ; osa161, 5 -AGGCGGGCCATTTACCGTAAG-3 ) psa72 (SspI/EcoRI). psa79 Vector encoding a P TtgR1 -driven expression of EGFP containing a MS2 box in the 5 UTR This work (P TtgR1 -MS2 box -EGFP-pA). P TtgR1 was excised from pmg10 (SspI/EcoRI) and ligated into PCR-amplified (osa160, 5 -tgttactggcgaattcacccactgcttactgg CTTATCG-3 ; osa161 (5 -AGGCGGGCCATTTACCGTAAG-3 ) psa73 (SspI/EcoRI). psa81 Vector encoding a P TtgR1 -driven L7Ae expression unit (P TtgR1 -L7Ae-pA). P TtgR1 was This work excised from pmg10 (SspI/EcoRI) and ligated into PCR-amplified (osa160, 5 -tgttactg gcgaattcacccactgcttactggcttatcg-3 ; osa161, 5 -AGGCGGGCCATTTAC CGTAAG-3 ) psa75 (SspI/EcoRI). psa83 Vector encoding P TtgR1 -driven expression of d2eyfp containing a C/D box in the 5 UTR This work (P TtgR1 -C/D box -d2eyfp-pa). d2eyfp was excised from d2eyfp-n1 with AgeI/XbaI and cloned into psa78 (AgeI/XbaI). psa84 Vector encoding P TtgR1 -driven expression of d2eyfp containing an MS2 box in the 5 UTR This work (P TtgR1 -MS2 box -d2eyfp-pa). d2eyfp was excised from d2eyfp-n1 with AgeI/XbaI and cloned into psa79 (AgeI/XbaI). psa89 Vector encoding P ETR2 -driven expression of d2eyfp containing a MS2 box in the 5 UTR (P ETR2 -MS2 box -d2eyfp-pa). P ETR2 was excised with from pww37 (SspI/EcoRI) and cloned into psa84 (SspI/EcoRI). This work psa90 Vector encoding P ETR2 -driven expression of MS2 (P ETR2 -MS2-pA). P ETR2 was excised This work from pww37 (SspI/EcoRI) and cloned into psa95 (SspI/EcoRI). psa91 Vector encoding P ETR2 -driven expression of L7Ae (P ETR2 -L7Ae-pA). P ETR2 was excised from pww37 (SspI/EcoRI) and cloned into psa81 (SspI/EcoRI). This work psa95 Vector encoding P TtgR1 -driven expression of MS2 (P TtgR1 -MS2-pA). P TtgR1 was excised This work from pmg10 (SspI/EcoRI) and ligated into PCR-amplified (OSA160, 5 - tgttactggcgaattcacccactgcttactggcttatcg-3 ; OSA161, 5 -AGGCGGGCCAT TTACCGTAAG-3 ) psa74 (SspI/EcoRI). psa108 Vector encoding P TtgR1 -driven expression of dsred-express-dr containing a C/D box in the This work 5 UTR (P TtgR1 -C/D box -dsred-pa). DsRed-Express-DR was excised from pdsred-express- DR with AgeI/NotI and cloned into psa83 (AgeI/NotI). psa117 Vector encoding P hcmv -driven expression of dsred-express-dr containing a MS2 box and a C/D box in the 5 UTR (P hcmv -MS2 box -C/D box -dsred-pa). The MS2 box and CD box were inserted by PCR with oligonucleotides osa159 (5 PhosTGGGTCTCCCTATAGTGAGT C-3 ) and osa219 (5 -cctagatctccgtgaggatcacccacggggatccaccggtcgccaccatggggcgtgatgc gaaagctgaccctgcctcctccgaggacgtcatcaaggagttc-3 ) using pmm60 as This work 13

14 RESEARCH SUPPLEMENTARY INFORMATION template. pmm60 Vector encoding P hcmv -driven expression of dsred-express-dr (P hcmv -dsred-pa). DsRed-Express-DR was excised with EcoRI/NotI from pdsred-express-dr and cloned into pcdna3.1 (EcoRI/NotI). This work Abbreviations: C/D box, RNA motif specifically binding to the L7Ae protein; d2eyfp, destabilized variant of the enhanced yellow fluorescent protein, DsRed-Express-DR, destabilized red fluorescent protein; EGFP, enhanced green fluorescent protein; ET1, macrolide-dependent transactivator; His6, hexameric histidine tag; L7Ae, archaeal ribosomal protein L7Ae; MS2, monomeric variant of the phage MS2 coat protein; MS2 box, RNA motif specifically binding to the MS2 protein; P ETR2, macrolide-responsive promoter; P PolII, RNA polymerase II promoter; P SV40, simian virus 40 promoter; SEAP, human placental secreted alkaline phosphatase; TtgA1, phloretin-dependent transactivator; VP16, Herpes simplex-derived transactivation domain; P hcmv, human cytomegalovirus immediate-early promoter. Restriction endonuclease-specific sites are underlined in oligonucleotide sequences. Annealing base pairs contained in oligonucleotide sequences are shown in capital letters. Fusco, D. et al., Single mrna molecules demonstrate probabilistic movement in living mammalian cells. Curr. Biol. 13, (2003). 14

15 RESEARCH Plasmid (ng) A ANDNOT B NOT B B ANDNOT A NOT A A ANDNOT B red NOT B red psa psa psa psa psa pww pmg filler plasmid total amount Table S2a. Composition of the N-IMPLY components transfected into human cells (HEK-293). Expression vectors and ratios used for the assembly of the N-IMPLY gates and relevant control experiments (ctr). To standardize transfection conditions, all component mixtures were adjusted to equal DNA concentrations by addition of an inert bacterial filler plasmid (pcoladuet TM -1; Merck Chemicals Ltd., Nottingham, United Kingdom). (see Table S1 for detailed description of vector genetics). Plasmid (ng) XOR XOR w/o psa83 XOR w/o psa89 XOR w/o psa91 XOR w/o psa95 XOR w/o pww35 XOR w/o pmg11 Half- Subtractor d2eyfp/ dsred ctr psa psa psa psa psa pww pmg filler plasmid pd2eyfp/dsred total amount Table S2b. Composition of the biocomputer components transfected into human cells (HEK-293). Expression vectors and ratios used for the assembly of the XOR circuit, the half-subtractor network and relevant basic as well as decomposition control experiments (see Fig. S3 for illustration). To standardize transfection conditions, all component mixtures were adjusted to equal DNA concentrations by addition of an inert bacterial filler plasmid (pcoladuet TM -1; Merck Chemicals Ltd., Nottingham, United Kingdom). (see Table S1 for detailed description of vector genetics). Plasmid (ng) AND AND ctr Half- Adder psa psa psa psa psa pww pmg pmm filler plasmid total amount Table S2c. Composition of the biocomputer components transfected into human cells (HEK-293). Expression vectors and ratios used for the assembly of the AND gate, AND control (ctr) gate and the half-adder network. To standardize transfection conditions, all component mixtures were adjusted to equal DNA concentrations by addition of an inert bacterial filler plasmid (pcoladuet TM -1; Merck Chemicals Ltd., Nottingham, United Kingdom). (see Table S1 for detailed description of vector genetics). 15