Chapter 9 WHAT IS DNA?

Transcription

1 Notes DNA

2 Chapter 9 WHAT IS DNA?

3 DNA= Deoxyribonucleic Acid DNA s job is to hold the entire genetic code for the organism. Human, tree, bacteria, mushroom, paramecium, etc! ALL HAVE DNA! DNA is held on chromosomes (genes) in the NUCLEUS of every cell. DNA codes for all your traits. Each organism has a different strand of DNA that makes it different from all other organisms!

4 QUESTION How tall would a stack of books be that stores all of the genetic information in the DNA of ONE CELL? GUESS:

5 ANSWER As tall as a 19 story building! We have over 3 billion nitrogen bases put together in a specific way

6 IS DNA AN ORGANIC MOLECULE? Yes! Remember Nucleic Acids? (Carbohydrates, Proteins, Lipids, Nucleic Acids) Deoxyribonucleic Acid is a Nucleic Acid!

7 The structure of DNA DNA is in the form of a twisted ladder. This means that it looks like two ribbons twisted together. The scientific name for this is: DOUBLE HELIX

8 WATSON & CRICK In 1953, two men were credited with the discovery of the double helix. (They did not discover DNA, but they figured out what DNA looked like.) Their names were James Watson & Francis Crick.

9 DNA Structure DNA Notes Part 2

10 NUCLEOTIDES DNA is made of repeating DNA subunits called nucleotides that make up the entire DNA molecule. They contain the nitrogen bases, a sugar and a phosphate group. Nucleotides join together to make the long strand of DNA.

11 The bases are the rungs of the ladder There are four DNA bases: 1. Adenine (A) 2. Thymine (T) 3. Guanine (G) 4. Cytosine (C)

12 The sides of the ladder The sides of the ladder are made up of alternating sugars (deoxyribose) and phosphate groups.

13 DNA BASE PAIRINGS The DNA bases will always be paired in a specific way. A will always be paired with T T will always be paired with A C will always be paired with G G will always be paired with C

14 SO Because your DNA is two strands intertwined. It will look something like this: AATGGCACCGAATCGGTCATC TTACCGTGGCTTAGCCAGTAG These two strands are called COMPLIMENTARY SEQUENCES

15 DIFFERENT DNA = DIFFERENT ORGANISM Will an elm tree, a deer and a bacteria have the same DNA sequence? Of course not! How about you & the person you are sitting next to? NO! Each organism, even of the same species has a different DNA sequence!

16 SIMILAR ORGANISM = SIMILAR DNA Which pair has DNA sequences closest to the other? 1. Elm Tree & Deer 2. Elm Tree & You 3. Deer & You 4. You & The Person Next To You

17 ANSWERS 1. A deer would have a closer DNA sequence to you than an elm tree (because a deer is an animal, just like you!) 2. But, the person next to you will have an even closer DNA sequence to you than either the elm tree or the deer (because you are of the same species!) 3. But NO ONE (unless you have an identical twin) has the SAME DNA!!!!!!

18 WHAT MAKES DNA SEQUENCES DIFFERENT? The species that you belong to will determine about 99% of your gene combinations. (THESE ARE SHARED CHARACTERISTICS) It is passed along from generation to generation in the species. YOUR SPECIFIC PARENTS WILL DETERMINE THE OTHER <1% OF YOUR DNA SEQUENCE.

19 THE ORDER OF DNA BASES MAKES YOU- YOU! Even though there are only 4 nitrogen bases IN ALL THE ORGANISMS OF THE WORLD.it s the SEQUENCE of those bases that makes the differences! The sequence ATATGACCG codes for different traits than CGGATCTAA.

20 DNA Model Lab Use the materials in front of you to create a strand of DNA. When you are done, call me over to verify. If you are correct, take a picture and label all parts of your DNA The base pairs on the left side are: A C C T G

21 DNA Notes 3 DNA Replication and Protein Synthesis intro

22 WHY DO WE NEED DNA? Besides coding for all your traits, DNA helps in the process of making amino acids (which link together to form proteins). Remember proteins are important to you because they make up the structure of your body (organs, muscles, eye balls, skin, hair, etc)

23 THREE STEPS IN PROTEIN SYNTHESIS Synthesis = Making something Gene expression is the process by which inheritable information from a gene, such as the DNA sequence, is made into a functional gene product, such as protein or RNA. Protein synthesis = making proteins 1. DNA replication 2. RNA transcription 3. Amino acid (protein) translation

24 1. DNA REPLICATION Replication = copying DNA Replication means that the existing strand of DNA COPIES itself to make an exact replica. This new strand then goes to new cells (during cell division)

25 HOW DOES REPLICATION HAPPEN? 1. DNA is made of 2 strands (double helix). 2. The bases are paired up A-T, T-A, C-G, G-C. 3. An enzyme called a DNA helicase starts to break apart the hydrogen bonds that hold the bases together. 4. As the DNA unzips, new free-floating nucleotides attach themselves to each side of the DNA. 5. Two exact copies of the DNA strand now exist.

26 REPLICATION EXAMPLE ORIGINAL STRAND OF DNA: ACTACAGCATCGAGTACGCATG TGATGTCGTAGCTCATGCGTAC The original strand unzips : ACTACAGCATCGAGTACGCATG TGATGTCGTAGCTCATGCGTAC New bases attach themselves to the unzipped strand:

27 NEW BASES ATTACH ACTACAGCATCGAGTACGCATG TGATGTCGTAGCTCATGCGTAC TGATGTCGTAGCTCATGCGTAC ACTACAGCATCGAGTACGCATG NOW YOU HAVE 2 COPIES OF THE ORIGINAL STRAND!

28 Final Check! There is an enzyme called a DNA polymerase that checks to make sure that there are no errors in the newly made DNA.

29 With exact DNA, you remain the same organism. WHY REPLICATION? Why do you need EXACT COPIES of DNA whenever you create a new cell? Because if your DNA did not copy EXACTLY, you would CHANGE! What kind of changes might happen?

30 DNA Notes 4 Transcription and Translation

31 Review from Last Class on Protein Synthesis THREE STEPS IN PROTEIN SYNTHESIS Synthesis = Making something Protein synthesis = making proteins 1. DNA replication 2. RNA transcription 3.Amino acid (protein) translation

32 2. RNA TRANSCRIPTION To continue our process of making proteins for your body, we need to make RNA in a process called TRANSCRIPTION. RNA=Ribonucleic Acid (NUCLEIC ACID) RNA contains the sugar ribose. Not deoxyribose RNA is a SINGLE STRAND (ribbon) that has 4 bases.

33 THE RNA BASES In RNA, the nitrogen bases are attached to a phosphate group & a sugar (ribose). Now, the bases are: A, C, G, U (uracil). How would the bases match up now? A U, C G, U A, G - C

34 TRANSCRIPTION The DNA strand again unzips and free floating RNA bases match up with the unwound DNA strand. DNA strand: TGATGTCGTAGCTCATGCGTAC NEW RNA strand: ACUACAGCAUCGAGUACGCAUG

35 TYPES OF RNA There are 2 types of RNA that each have a different job in the process of making proteins. 1. mrna= RNA on the strand 2. trna= Transports amino acids to ribosomes to be assembled into proteins

36 3. PROTEIN (AMINO ACID) TRANSLATION After we have RNA, we can now make amino acids (which link together to form proteins.) How does this happen? 1. The RNA strand gets split into CODONS (3 RNA bases). Example: ACU

37 Translation 2. Once the RNA is split into codons, your body matches them up to a code to form the amino acid. There is a chart that has all 20 of the amino acid codes on it, along with a start & stop:

38 To use the chart: EXAMPLE mrna CODON: ACU Look on the left side of the chart to find the first base (A). Look on the top of the chart to find the second base (C). Look on the right side of the chart to find the third base (U). THE AMINO ACID IS: Threonine

39 Abbreviating the amino acids Instead of writing out the entire name of each amino acid, you can abbreviate. The rule is: use the first 3 letters of the amino acid as the abbreviation. Except when the amino acid ends in the word acid, in which case you use the first 2 letters and a capital A.

40 The role of trna: Transfer RNA (trna) moves the mrna codons to the ribosomes from the cytoplasm so they can be translated into proteins. Each trna molecule only fits onto ONE mrna codon. Its ANTICODON fits onto the mrna codon like a puzzle piece and carries it away.

41 THE END OF TRANSLATION Once the protein chain has been made, the body codes stop. The protein strand is cut and it goes off to do a job (like be a hair or skin protein.) So the ORDER of amino acids determines the protein & how we are put together!

42 WHAT HAPPENS IF THE AMINO ACID ORDER CHANGES? THE PROTEIN CHANGES! And if the protein changes YOU CHANGE!

43 Mutations DNA Notes 5

44 GENETIC MUTATIONS A mutation is any permanent change in the DNA sequence. Mutations are caused by MUTAGENS like UV radiation, X-rays, toxins, etc. Some mutations are silent (do not have any effect). Some mutations have major effects like Down s Syndrome or cancer.

45 TYPES OF MUTATIONS 1. Point mutations 2. Frameshift mutations 3. Chromosomal mutations

46 POINT MUTATIONS Point mutations are when ONE DNA BASE is CHANGED. THE DOG BIT THE CAT THE DOG BIT THE CAR What happened in the DNA strand? What probably happened in the body?

47 FRAMESHIFT MUTATIONS Frameshift mutations are when ONE DNA BASE is ADDED or DELETED. THE DOG BIT THE CAT THE DOG BIT HEC AT What happened in the DNA strand? What probably happened in the body?

48 CHROMOSOMAL MUTATIONS A chromosomal mutation is when MANY DNA BASES are CHANGED, ADDED or DELETED. THE DOG BIT THE CAT THE DGB ITE HAT C What happened in the DNA strand? What most likely happened in the body?

49 CAN MUTATIONS BE PASSED ON TO OFFSPRING (progeny)? Some can! If the mutation occurs in a BODY cell, they are called NON-INHERITED mutations. If the mutation occurs in a SEX cell (gamete) they are called INHERITED mutations & can be passed on.

50 Are all mutations bad? NO! Some mutations, like the ones that can be passed on to offspring, can create GENETIC VARIATION, or changes for the species.

51 Sex Cell Division MEIOSIS

52 AFTER DNA REPLICATION, WHERE DOES THE NEW DNA STRAND GO? The new DNA strand goes into a new cell. If it is a body cell, it goes to a new cell by MITOSIS. If it is a sex cell (sperm or egg) it goes there by MEIOSIS.

53 HOW DO WE PASS DNA ON TO OUR PROGENY (OFFSPRING)? We, as humans, along with many other types of organisms, pass on our DNA through sexual reproduction. This simply means that 2 gametes (1 sperm & 1 egg) fuse to form a zygote, exchange DNA, and create new gene combinations.

54 Meiosis This process is done by the process called MEIOSIS. Remember the reproduction of body cells (known as somatic cells) is called MITOSIS. MEIOSIS is the reproduction of sex cells.

55 THE STEPS OF MEIOSIS Meiosis is divided into 2 parts: MEIOSIS I MEIOSIS II 1. Interphase 6. Prophase 2 2. Prophase 1 7. Metaphase 2 3. Metaphase 1 8. Anaphase 2 4. Anaphase 1 9. Telophase 2 5. Telophase Cytokinesis

56 During each of these phases, certain things happen: The steps in Meiosis I are VERY similar to mitosis And remember the point of meiosis is to create 4 cells from the original 1 cell.

57 MEIOSIS 1 1. Interphase: The cell grows & chromosomes double (46 to 92) 2. Prophase 1: The nucleus goes away & chromosomes (92) become visible 3. Metaphase 1: The chromosomes (92) line up in the middle of the cell 4. Anaphase 1: The chromosomes begin to travel to the ends of the cell (46 on one end & 46 on the other) 5. Telophase 1: The nuclei comes back & the cell starts to split into 2 cells

58 This is where it gets a little different. Instead of splitting into 2 cells & that s the end of the process.the 2 new cells undergo another division. At the end we want 4 cells, right?

59 MEIOSIS 2-occurs in both new cells 6. Prophase 2: chromosomes (46 in each cell) are visible & nuclei disappear 7. Metaphase 2: chromosomes (46 in each) line up in the middle of each cell 8. Anaphase 2: chromosomes (23 now in each end) start to move to the ends of each cell 9. Telophase 2: the 2 cells start to split into 4 cells (each with 23 chromosomes) 10. Cytokinesis: 4 new cells are formed

60 Putting it all together At the end of mitosis our chromosomes are arranged in homologous pairs. Each cell contains 23 pairs of chromosomes (46 total) Since they are in pairs, we also refer to the total number of doubled chromosomes as the diploid number. (46 in humans)

61 Homologous chromosomes in meiosis When our cells are undergoing meiosis, each homologous pair divides & they become single chromosomes- or HAPLOID (n). In which phases of mitosis & meiosis are there haploid chromosomes present? (HINT: are there ANY in mitosis)?

62 CROSSING OVER Crossing over is another way to create genetic variation. During prophase, the chromosomes are so tightly wound together, that some of the genes, called jumping genes leave their chromosome & go (cross over) to another. This results in recombination of genes & genetic material, which creates all new possibilities in offspring!

63 WHY MEIOSIS? To make sperm and egg (gametes or sex cells) and eventually produce offspring! Meiosis creates HAPLOID CELLS (23 chromosomes in each) (sperm & egg) that can join together to create a DIPLOID CELL (46 chromosomes in each). Meiosis creates new possibilities for offspring s DNA they are NOT exactly like their parents!

64 When do these processes take Mitosis: place? Takes place any time we need to replace a cell Meiosis: Males: Males are creating sperm all the time! Females: All eggs are created before the female is born!

65 MITOSIS vs. MEISOIS Your assignment is to compare mitosis with meiosis. These 2 processes are very similar, but they have some major differences too.

66 Example: A horse and a donkey can mate to produce a mule, but the mule is almost always sterile. Horses have a diploid # of 60. Donkeys have a diploid # of How many chromosomes would the mule receive from each parent? 2. What is the diploid number of the mule? 3. Why do you think mules are sterile?