C. acetobutyricum. Initial co-culture. Transfer 1

Transcription

1 a Co-culture C. acetobutyricum b Initial co-culture Transfer 1 Transfer 2 c Supplementary Figure 1: Persistence of the bacteria in co-culture. (a) Specificity of genes used to follow and in pure culture and cocultures. The genes used for pcr were dsra (a gene encoding desulfoviridine) for D. vulgaris, and endog (encoding endoglucanase) for. Co-culture, and pure cultures of and. (b) Persistence of the two bacteria in co-culture was followed by pcr using, the same genes, in the initial co-culture and after two transfers to a new medium (gy medium). (c) The viability of the two bacteria in co-culture was assessed by the ability of to form colonies on Postgate E plates and to form colonies on rcm plates incubated under anaerobic conditions.

2 a Count Co-culture 0 h h h b Proportions in the coculture (%) log (Side scatter height) Time (h) Supplementary Figure 2. Growth of and in pure culture and in co-culture. Flow cytometer analysis of co-culture and pure cultures according to the side scatter parameter (ssc-height). Bacterial cells from single cultures and co-culture were fixed with paraformaldehyde as described by Amann et al. [Amann RI, Binder BJ, Olson RJ, Chisholm SW, Devereux R, Stahl DA. (1990) Combination of 16S rrna-targed oligonucleotide probes with flow cytometry for analyzing mixed microbial populations Appl Environ Microbiol 56: ] and analyzed with a flow cytometer (facs calibur 3ca bd Biosciences). The side scatter parameter measured the ratio of to in the co-culture. A series of dilutions from 1:10 to 1:100 in phosphate buffer for and coculture, depending on the growth curve, were needed to avoid having a cell count greater than 300 events/s. (a) The resulting distribution curves were examined to estimate the percentage of each bacterium in the co-culture after 0, 18 and 30 h. (b) Percentages of the two strains in the co-culture, as labeled. The value at 30 h is not color-coded, because the corresponding peak in (a) could not be resolved.

3 20 h 30 h Gas phase Liquid phase Coverslip Supplementary Figure 3. Scanning electron microscopy images of and in co-culture. Images at 20 and 30 h show interaction of the two bacteria in co-culture. Coverslips were fixed with glutaraldehyde and dried chemically with hexamethyldisilazane, and then coated with gold-palladium particles (10nm) with a fine coat-ion sputter jfc Digital images were acquired with the newtec System. At 20 h both bacteria were present, with physical contact and aggregate formation. At 30 h, more aggregates were formed and the formation of an exopolysaccharide-like network between bacteria appeared. Scale bar = 1 µm. The experimental set-up is illustrated at the bottom.

4 a Phase contrast fm4-64 stain wga-fitc stain b Overlay 6.4 x Supplementary Figure 4. Fluorescence microscope analysis of a network between D. vulgaris and in co-culture. Bacterial cells attached to a coverslip after 20 h growth were stained with wga-fitc (green) for peptidoglycan and fm4-64 (red) for cytoplasmic membranes, observed with an automated inverted epifluorescence microscope te-2000 (Nikon), and images captured with a Cool snap hq. (a) Pure cultures of (grown in Starkey medium) and (grown in gy medium) stained with fm4-64 and wga-fitc. (b) Co-culture of and, grown in gy medium, stained in the same way. Scale bar = 2 μm.

5 a 3.5 x labeled 3.5 x b D. vulgaris 3.5 x labeled D. vulgaris 3.5 x Supplementary Figure 5. Exchange of calcein between and. (a) growing exponentially in Starkey medium was labeled with calcein, mixed with unlabeled and visualized by fluorescence confocal microscopy after 24 h of incubation at 37 C in gy medium. (b) Exponentially growing labeled with calcein was washed, mixed with unlabeled and visualized by microscopy after 24 h of incubation at 37 C in gy medium. Scale bar = 2μm.

6 0 h 24 h D. vulgaris D. vulgaris Supplementary Figure 6. Exchange of green fluorescent protein between D. vulgaris and. growing exponentially in Starkey medium was labeled, washed in gy medium, mixed with unlabeled and visualized by fluorescence confocal microscopy at time zero, or after 24 h of incubation at 37 C in gy medium. The yellow arrows in the images after 24h mark two of the many cells that have received the green fluorescent protein and thus show green fluorescence. Scale bar = 2 µm.

7 100 Metabolite distribution of electron equivalents (%) 80 H 2 H Butyrate Butyrate 20 0 Acetate Lactate Acetate Co-culture Supplementary Figure 7. Electronic balance for a pure culture of C. acetobutylicum and co-culture. The percentage of electron equivalent of each metabolite was calculated at the end of growth (40 h).to determine the redox balance, the amount of electrons contained in H2 2 gas corresponded to a cumulated amount measured in the head space over the whole experiment. As liquid and gas samples were taken periodically, the amount of glucose sampled for analysis should also be considered as the part of the substrate that cannot be converted to H2. 2 Therefore a full mass electron mass balance was determined at each sampling time by considering the sampling volume and composition.

8 Glucose Glucose 6-P Lactate Lactate dehydrogenase Pyruvate Glycolysis Ferredoxin ox H 2 Pyruvate ferredoxin oxidoreductase CO 2 Ferredoxin red Hydrogenase H + Butyrate kinase ATP Butyrate Butyryl-CoA Phosphotransbutyrylase Phosphotransacetylase Acetyl-CoA Acetate kinase ATP Acetate Acetaldehyde dehydrogenase NAD(P)H ethanol dehydrogenase Ethanol Supplementary Figure 8. Metabolic pathways for H2 2 production in growing on glucose. Dashed arrows represent transformations requiring more than one enzyme; dotted arrows represent transport steps.

9 GY alone GY+20 mm lactate GY+ 20 mm sulfate GY+ 20 mm lactate + 20mM sulfate Glucose alone Co-culture Supplementary Table 1. Effect of the presence of lactate, sulfate and lack of yeast extract on growth of the co-culture and pure cultures. The numbers shown are A 600nm!values after incubation for 30 h. Yeast extract alone with no glucose did not support growth in either co-culture or pure culture.

10 Strains Genes Sequence (5-3 ) C.acetobutylicum endog L(CA_C0825) endog R ATGCGGCTACAGCTGAACTT ATTCTTTGCACCGGTGTCTC D.vulgaris dsra L (DVU 0402) dsra R GAATTCGCCTGCTACGACTC TCCTTCCAGGTACCGATGAC Supplementary Table 2. Primers used for PCR quantification for and in pures cultures and cocultures.

11 Strains Genes Sequence (5-3 ) ARN16s L ARN16s R ldh L CA_C0267 ldh R pfor L CA_C2499 pfor R TGGGGAGCAAACAGGATTAG TAAGGTTCTTCGCGTTGCTT CAGAAGGGGAAGCAATGGAC ACCTGGTTTCTGTGCTGCTC AAGCCTGCTGCAGAACAAAT TGAGCATCCAGTAGCGTTTG Supplementary Table 3. Primers used for reverse transcription PCR for gene expression of C. acetobutylicum in pure culture and co-culture.