SUPPLEMENTARY INFORMATION

Transcription

1 SUPPLEMENTARY INFORMATION DOI: /NNANO DNA sequencing with electrical conductance measurements of a DNA polymerase Yu-Shiun Chen, Chia-Hui Lee, Meng-Yen Hung, Hsu-An Pan, Jin-Chern Chiou, and G. Steven Huang NATURE NANOTECHNOLOGY 1

2 Materials and Methods Φ29 DNA polymerase, T4 DNA polymerase, T7 DNA polymerase, and DNA polymerase I (E. coli) were purchased from NEB or Invitrogen. The standard reaction buffers for the Φ29 DNA polymerase (50 mm Tris-HCl ph 7.5, 10 mm MgCl 2, 10 mm (NH4) 2 SO 4, 4 mm DTT), T4 DNA polymerase (33 mm Tris-acetate ph 7.9, 66 mm sodium acetate, 10 mm magnesium acetate, 1 mm DTT), T7 DNA polymerase (20 mm Tris-HCl ph 7.5, 10 mm MgCl 2, 1 mm DTT), and DNA Polymerase I (10 mm Tris-HCl ph 7.9, 50 mm NaCl, 10 mm MgCl 2, 1 mm DTT) were made according to the supplier s specifications. The reaction buffer was diluted 1,000,000 folds in the experiment. Ensemble experiments were performed to verify if the diluted reaction buffer and diluted magnesium affects polymerase activity (Figure S6). The polymerase activity remained unchanged in the presence of diluted reaction buffer. When the concentration of magnesium was lower than 10-7 M, increase of polymerase activity was observed. Under our experimental conditions and within our time span, the turnover rate of the polymerases remained unchanged with or without the buffer dilution (Figure S7). However, in the presence of reaction buffer, the noise levels increased temporally, likely due to the gradual accumulation of charged particles on the electrodes. In the current study,

3 single-molecule DNA sequencing reactions were conducted in the diluted buffer. Differential effect of diluted magnesium in ensemble experiment versus single-molecule experiment might due to the lack of enzyme-enzyme interaction in the single-molecule experiment. Conjugation of polymerases Rabbit anti-mouse IgG (H+L) antibody (ZyMax TM Grade, Invitrogen, CA) was reconstituted in 10 mm phosphate buffered saline, ph 7.4 to a final concentration of 2 mg/ml. 5 % glutaraldehyde (Sigma) was added to the antibody solution at a final concentration of 0.2 %. Conjugation was performed by mixing 0.5 mg activated antibody with 1.5 mg DNA polymerases and 100 ul phosphate buffer followed by incubation at 25 C for 2 hours. The reaction was terminated by adding phosphate buffer to a final volume of 1 ml. The conjugates were purified by passage through a protein A column. The supernatants were secondary purified by high pressure liquid chromatography (HPLC), with HPLC pre-column and column (Discovery BIO GFC 100 HPLC Column L x I.D. 5 cm x 4.6 mm; DiscoveryR BIO GFC 100 L x I.D. 30 cm x 4.6 mm). Polymerase activity assay

4 Φ29 DNA polymerase (0.1 g/ l), M13mp18 template (0.25 g/ l), primer (200 ng/ l), dntp (2.5 mm), MgCl 2, LC Green, and Φ29 DNA polymerase standard reaction buffers (50 mm Tris-HCl ph 7.5, 10 mm MgCl 2, 10 mm (NH4) 2 SO 4, 4 mm DTT) were purchased from NEB or Invitrogen. The reaction buffer was diluted 1 to 10 8 folds and the concentration of MgCl 2 ranged from 10-4 to 10-9 M. After the reaction, the fluorescence of LC Green was measured by the icycler iq Detection System (Bio-Rad). The activity was expressed as amount of fluorescence relative to the polymerase activity of Φ29 DNA polymerase in 1X buffer.

5 Table. S1 Sequences of the oligonucleotide template and primers Poly A Oligo 1 Oligo 2 Oligo 3 Oligo 4 Oligo 5 Template Primer Template Primer Template Primer Template Primer Template Primer Template Primer cgccgcggag ccaagaaaaa aaaaaaaaaa aaaaattgca tgtcctgtga* tcacaggacatgcaa gatcgatcgatcgatcgatcgatcgatcgatcgatcgatcgatc gatcgatcgatcgatcgatc ttccggaattccggaattccggaattccggaattccggaattccggaa ttccggaattccggaa aagaagttac gattgcgcgg gtcctcagaa tgaacattca gagaatcata ctaacaccag aaaccagtac ataggccaca gcgttcttca acgccggtac gaattactcc ccattgaaga cgccgcggagccaag cttggctccgcggcg cgccgcggagccaagccgggcccggccggccgcgcttgcatgtcctgtga tcacaggacatgcaa cgcatgatctgtacttgatcgacccgccgcggagccaattgcatgtcctgtga tcacaggacatgcaa *All sequence are written from 5 to 3.

6 Figure S1 The dynamic response of the quantum dot-conjugated prot platform. Dynamic response is derived by sending high-frequency laser waveforms to the quantum dot-conjugated prot and measuring the electrical signal. (a) A schematic drawing of a quantum dot (green) conjugated to IgG bound to the Fc domain of prot. (b) A pulsed laser waveform was applied to the quantum dot-conjugated prot, and the photon-induced fluctuation of I SD was measured. After compensating for the time delay ( ms), the laser waveform (red) and the detected electrical signal (black) were synchronized at a frequency of 1.7x10 9 s -1. The dynamic response of prot fell within the nanosecond timescale.

7 Figure S2 Selectivity of giving one type of nucleotide at a time. Single-molecule sequencing reaction is performed using Olig-1 and corresponding primer. (a) The first round of sequencing was initiated by a dntp pulse and randomly stopped due to the lack of substrate. After the first round of sequencing, nucleotide triphosphates are delivered to the platform one type of nucleotide at a time, in this case, by G, A, T, and C. Each dntp was provided for 0.5 second, followed by 0.5-s wash. Blue lines indicate the duration of wash. Red lines indicate supplying of dntp. (b) Incorporation of G enlarged from (a). (c) Incorporation of A enlarged from (a). (d) Incorporation of T enlarged from (a). (e) Incorporation of C enlarged from (a). (f) Sequencing reaction same as (a) with prolonged duration of dntp (1 minute) and longer wash time (1 second). (g) Incorporation of G enlarged from (f). (h) Incorporation of A enlarged from (f). (i) Incorporation of T enlarged from (f). (j) Incorporation of C enlarged from (f). In each of the enlarged trajectory, the spikes occurred when the correct substrate interacts with the active site of the polymerase. For example, during the synthesis of G, injection of dgtp promoted spikes. After the incorporation of G, translocation occurs and dgtp is no longer the correct substrate. Consequently, in the presence of dgtp no spike is observed.

8

9 Figure S3 Termination of DNA polymerization by dideoxynucleotide. Sequencing reaction is performed providing dntp mixture containing dgtp, datp, and dttp. The sequencing reaction is stopped by the addition of ddctp. Addition of dntp creates binding spikes but not reaction plateaus.

10 Figure S4 Blind-test sequencing using randomly mixed DNA templates. A collection of templates (Oligo-4, Oligo-5, PolyA) are mixed, annealed with common primer, and sequenced by Φ29-proT. Sequencing trajectory is shown on the top. Expanded trajectories are shown to visualize sequencing plateaus for each template.

11 Figure S5 Conductance trajectories of Φ29, T4, T7, and DNA polymerase I sequencing Oligo-3. Oligo-3 is annealed with the primer and delivered to DNA polymerase-conjugated prot through a microfluidic channel until a stable current is established. The injection of dntps initiates the sequencing reaction, and the conductance is recorded in real time. The trajectories are derived from the sequencing reactions of Φ29 (a), T4 (b), T7 (c), and DNA polymerase I (d).

12 Figure S6 Activity of Φ29 and Φ29-IgG conjugate in diluted buffer and magnesium ion. Activity of phi29 and F29-IgG conjugate is assayed as described in the Materials and Methods using M13mp18 as template in ensemble experiments. The double-helical DNA product is stained by LC green and the total fluorescence is detected. The activity was expressed as percent relative amount of fluorescence compared to the activity of Φ29 DNA polymerase in 1X buffer containing 10 mm MgCl 2. (a) Activity of Φ29 (black) and Φ29-IgG conjugate (red) versus fold of dilution. Standard reaction buffer is diluted from 1 to 10 8 folds. All buffers contain 10 mm MgCl 2. (b) Activity of Φ29 and Φ29-IgG conjugate versus [MgCl 2 ]. Magnesium ion varies from 10-4 M to 10-9 M in 1X reaction buffer. (c) Activity of Φ29 and Φ29-IgG conjugate versus fold of dilution. Φ29 is diluted at the same fold as buffer. (d) Activity of Φ29 and Φ29-IgG conjugate versus [MgCl 2 ]. Φ29 is diluted at the same fold as MgCl 2.

13

14 Figure S7 Single-molecule sequencing trajectories of Φ29 in buffers diluted from standard reaction buffer by 10 2, 10 3, 10 4, 10 5, and 10 6 folds. Single-molecule sequencing reaction is performed to Oligo-1 in buffers diluted from the standard reaction buffer of Φ29 (50 mm Tris-HCl ph 7.5, 10 mm MgCl 2, 10 mm (NH4) 2 SO 4, 4 mm DTT). The turnover rates are calculated by counting number of plateaus per second and averaged from >150 reactions.