Optimizing CRISPR ribonucleoprotein components for precision genome editing

Transcription

1 Optimizing CRISPR ribonucleoprotein components for precision genome editing Justin Barr Sr. Product Manager, Integrated DNA Technologies VIB CRISPR User Meeting 18 September

2 Agenda Overview of CRISPR-Cas9 components Optimization and selection of the components: Guide RNAs Cas9 nuclease Homology-directed repair (HDR) templates Supporting materials (enhancers) Questions and discussion 2

3 CRISPR-Cas9 genome editing RNA-guided endonuclease 20 nt protospacer PAM site (NGG) Native two-part crrna and tracrrna or one piece sgrna Alt-R crrna:tracrrna ribonucleoprotein (RNP) complex 3

4 Implementing CRISPR-Cas9 gene editing 4

5 One-piece or two? Single grna vs. natural 2-part system Good for expression formats (virus, plasmid) Good for pooled whole genome viral libraries IVT easy, but toxic (immune activation) Synthetic sgrna works well, expensive to make Work better in high nuclease environments Poor for expression formats; IVT difficult Synthetic RNA easy, inexpensive to manufacture Easier to employ complex mod patterns Good for arrayed, focused libraries IVT = in vitro transcription, sgrna = single guide RNA, 2-part system = crrna + tracrrna 5

6 Chemically synthesized grnas allow for modifications Introduce chemical modifications to: Improve nuclease stability, increase potency Reduce risk of triggering innate immune response Manufacturing crrnas target specific, need thousands in small scale tracrrna is universal, can synthesize in large scale and aliquot to smaller tubes at large cost savings than making this sequence for every grna Complexed crrna + tracrrna can be more cost effective vs. single sgrna sgrna has its own utility, particularly for applications where nuclease exposure is high but will always cost more than the 2-part system due to inefficiency in synthesis 6

7 Empirical testing of over 400 modified RNAs cggaauaaaauugaacgauac*g*a 5 u A guccguuaucaacuug A A AGCCACGGUGAAA tracrrna G UCGGUGCU*U*U 3 5 C*U*U*AUAUCCAACACuuCGuGGuuuUAGAGCUAU*G*C*U 3 AGCU = 2 OMe RNA agcu = RNA * = PS bond 20 base protospacer guide domain 16 base tracrrna binding domain = Major loss of function with 2 -mod = Minor loss of function with 2 -mod crrna = Loss of function varies with sequence 7

8 Transfection of IVT sgrnas can be toxic to cells Successful gene editing Transfection of IVT sgrnas sometimes result in: Large scale cell death Induction of innate immune response 8

9 IFNa stimulation in human PBMCs Sample Cytotoxicity IFNα IVT sgrna +PPP Yes +++ IVT sgrna PPP Yes ++ 1-part sgrna, modified No 2-part crrna + tracrrna, unmodified No ++ 2-part crrna + tracrrna, modified No DNA HDR template, unmodified At high doses + PBMC = peripheral blood mononuclear cell PPP = triphosphate HDR = homology-directed repair 9

10 Publications relating to CRISPR immune effects 10

11 Alt-R grna Options crrna:tracrrna & sgrna Structure Alt-R 2 part Alt-R 2 part XT Alt-R sgrna grna format Components Sizes (nt) Annealing required Alt-R CRISPR-Cas9 crrna & tracrrna crrna tracrrna Alt-R CRISPR-Cas9 crrna XT & tracrrna crrna XT tracrrna Alt-R CRISPR-Cas9 sgrna sgrna Y Y N 100 Modifications Moderate High Moderate Applications Cas9-expressing cells RNP in most cell types Co-delivery with Cas9 plasmid/cas9 mrna RNP under difficult experimental conditions (e.g., high nuclease environments) 11

12 Chemically modified Alt-R 2-part and sgrnas have similar editing efficiency when used as RNP in most cells IDT chemically synthesized 2-part vs. sgrna HEK nm RNP 1.2 µl RNAiMAX reagent (Thermo Fisher) 48 hr Modified sgrnas cost ~4X more than modified 2-part grnas, but there is a role for both types of reagents. In some applications, sgrnas perform better. For example, when using: Cas9 mrna instead of RNP RNP in CD34 + cells In most cases, the 2 classes of reagents are similar, but the sgrnas cost more. 12

13 On-target analysis of grna variants by Cas9 source HPRT 12 sites in HEK293 cells INDEL by NGS Ribonucleoprotein delivery (RNP) grna:cas9 protein = 1.2:1 ratio 3 µm Alt-R Electroporation enhancer Cas9 plasmid & mrna Co-delivery with grna 1 µg plasmid or mrna 13

14 Collaborator Data: CD34 + hematopoietic stem cells (HSCs) Ayal Hendel Bar Ilan University Israel In some cell types, sgrnas can perform better Site specific effects are sometimes seen 14

15 Identical repair profile for each grna & Cas9 source RNP delivery shown; identical profile with Cas9 mrna or plasmid 15

16 Cas9 source and optimization 16

17 Cas9 protein is rapidly degraded - fewer off-target effects Western blot Off-target indel production Liang X, Potter J, et al. (2015) Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection. J Biotechnol. 208: (Thermo) 17

18 DNA-free RNP methods have lower off-target editing Cas9 stable cell line RNP into normal cells 18

19 Extent of OTE problem varies with target site and method Worst Better Plasmid, virus anything with sustained overexpression of Cas9 and grnas Cas9 mrna RNP with modified synthetic grnas 19

20 Cas9 mutants with reduced OTEs 20

21 Zhang and Joung mutants have lost on-target activity as RNP espcas9 = Zhang/MIT mutant SpCas9-HF1 = Joung/MGH mutant 21

22 Genetic screen for higher specificity Cas9 in E. coli 250,000 mutants from low-fidelity PCR library On-target site Toxin Must cleave On Off-target site Essential gene Must not cleave 100 hits from primary screen, then change on/off target sites & repeat 9 hits from secondary screen purify protein, test in human cells 22

23 New IDT HiFi Cas9 mutant retains on-target activity espcas9 = Zhang/MIT-Broad mutant SpCas9-HF1 = Joung/MGH mutant Lipofection (RNAiMAX reagent) at 10 nm in HEK-293 cells 23

24 Relative performance at 3 known off-target sites Lipofection RNAiMAX at 10 nm in HEK293 cells 24

25 Use of IDT HiFi Cas9 in human CD34 + HSCs at the HBB locus We performed an unbiased evaluation of several versions of high fidelity Cas9 enzymes in primary human stem cells. We have been very impressed with the characteristics of this new IDT enzyme. Unlike other versions, this version consistently gives us high on-target editing activity, while having low off-target activity. Because of the retained excellent on-target activity and improved specificity profile, we are excited to use this version in our future experiments focused on developing novel genome editing based therapies for severe diseases with unmet medical needs. Danny Dever Matt Porteus Stanford University 25

26 Recently published article with additional details 26

27 Extent of OTE problem varies with target site and method Worst Better Plasmid, virus anything with sustained overexpression of Cas9 and grnas Cas9 mrna RNP with modified synthetic grnas Best Mutant HiFi Cas9 RNP with modified synthetic grnas 27

28 Homology-directed repair optimization 28

29 HDR rate decreases significantly at positions >10 bases away from CRISPR-Cas9 cut site EcoRI cleavage (%) n o s s O D N Insertion position away from cut site (base pairs) 29

30 Modified donor oligos can improve HDR rates EcoRI cleavage (%) Amaxa nucleofection Jurkat cells - 4 µm RNP, 4 µm Electroporation Enhancer 3 µm ssodn (40 nt homology arms, non-targeting strand) unmodified ssodn PS modified ssodn 0 TNPO3-145-AS TNPO3-175-S MET27475-AS MET27554-S HPRT38087-AS Unmodified ssodn PS modified ssodn ATAATCAGGTTCTGTTCCATAAACTCTGGATTGCATTCCTgaattcACATGGAAATGCCTCTGGAGTGTATTCTCACAGAAAAGAG A*T*AATCAGGTTCTGTTCCATAAACTCTGGATTGCATTCCTgaattcACATGGAAATGCCTCTGGAGTGTATTCTCACAGAAAAG*A*G lowercase = EcoRI restriction site insertion * = PS 30

31 Improved activity CRISPR recombinant proteins Original proteins worked very well, but over the past several years we have learned more about the impact of NLS sequences, the structure of spacer arms that separate domains, and more Now available: WT Cas9 V3 HiFi Cas9 V3 D10A Cas9 Nickase V3 H840A Cas9 Nickase V3 dcas9 V3 Cas12a V3 (Cpf1) 31

32 Cas9 V1 vs. V3: potency at 8 sites 32

33 Major gain of function for Cas12a V3 (Cpf1) at 92 sites 33

34 Additional improvements for CRISPR Electroporation Enhancer HDR Enhancer 34

35 Increased editing with Electroporation Enhancer Genome Editing using Alt-R RNP in Jurkat cells 0 µm Cas9 EE 5 µm Cas9 EE Total Editing Efficiency by NGS (%) S S S S S AS AS AS AS AS AS AS guide RNA target site in the HPRT1 gene 100-nt single-stranded DNA oligonucleotide Minimized sequence homology with mammalian genomes Empirical testing of sequences for best performance 35

36 Alt-R electroporation enhancer: essential for the screen Able to reduce RNP concentration to around 1mM, reducing the cost of doing an electroporation RNP screen in primary cells Inès Royaux Janssen R&D, Discovery Sciences 36

37 HDR enhancer experiments HDR Enhancer is a small molecule compound that reduces NHEJ efficiency thereby shunting repair towards HDR. It is provided as a 3.55 mm concentrated solution in DMSO. Perform electroporation as usual, plate into medium containing mm Enhancer. Change to fresh medium without enhancer at hours post electroporation. Enhancer can show toxicity if cells are exposed for longer times. The following experiments demonstrate utility of the HDR Enhancer in HEK293 cells and Jurkat cells where Cas9 RNP is electroporated into cells targeting different sites using an 86 base ssdna oligonucleotide HDR template that introduces a 6 base EcoRI site into the CRISPR cut site. At 48 hours post electroporation, DNA is harvested and the site of interest in amplified by PCR. The amplicons are studied for the presence of the new EcoRI site. In some cases, total editing is examined too (which is the sum of NHEJ repair + EcoRI HDR insertion). 40 base homology arm 6 base RI site 40 base homology arm 86mer HDR template 37

38 HDR Enhancer: Dose response curve Amaxa nucleofection, Jurkat cells - HPRT targeting RNP 4 µm RNP, 4 µm Electroporation Enhancer, 3 µm ssodn EcoRI cleavage (%) - HDR No treatment DMSO only 10 µm 20 µm 30 µm T7EI cleavage (%) - total editing 3 to 6-fold improvement in HDR rates HDR improvement shows a dose dependent result HDR Enhancer in final media at indicated concentration. Media change after 24 hours Controls HDR Enhancer final concentration HDR - EcoRI Total editing - T7EI Ultramer ssodn designed to insert 6 bp EcoRI recognition site. 38

39 70 HDR Enhancer demonstrates robust improvement with Cas9 and Cas12a (Cpf1) nucleases Neon electroporation, Jurkat cells - 3 µm ssodn EcoRI cleavage (%) MET TNPO3 site1 TNPO3 site 2 HPRT control HPRT site 1 HPRT site 2 HPRT site 3 HPRT site 4 Alt-R S.p. Cas9 nuclease v3 Alt-R A.s. Cas12a (Cpf1) nuclease v3 No treatment DMSO 30 µm HDR Enhancer Ultramer ssodn designed to insert 6 bp EcoRI recognition site HDR Enhancer present in final incubation media (media change after 24 hours) 39

40 Conclusions Many paths are available to perform CRISPR genome editing Use of RNP with chemically modified grnas gives high activity and reduced off-targets effects 2-part crrna:tracrrna is less costly, but sometimes the more expensive sgrna has benefits Standard 2-part, 2-part XT, and sgrna formats available from IDT Off-target effects (OTEs) can be a problem, even when using RNP methods Cleavage at the wrong site(s) is a problem which exists but is difficult to study except by NGS Toxicity via stimulation of the innate immune system occurs if you do not use modified RNAs HiFi Cas9 mutant retains on-target cleavage and has reduced off-target risk Electroporation Enhancer and HDR Enhancer can provide substantial performance improvements, especially under challenging conditions with otherwise low editing levels 40

41 Thanks to the scientists who contributed to these studies Integrated DNA Technologies Ashley Jacobi Garrett Rettig Michael Collingwood Mollie Schubert Rolf Turk Chris Vakulskas Nicole Bode Bernice Thommandru Michael Christodoulou Mirna Jarosz Patty Mudivarti Matt McNeill Coralville, Iowa USA 41

42 THANK YOU 42