Nucleotide substitutions in the diaa mutant alleles

Transcription

1 Supplementary Table S1 Nucleotide substitutions in the diaa mutant alleles Plasmid Nucleotide substitution in diaa Amino acid substitution Position pmn17 68 (CTT-CCT) L23P IV pmn (CTC-CCC) L45P IV pmn (TCC-TTC) S52F III pmn (GCT-ACT) A53T III pmn (CGG-CAG) R71Q II pmn (CTA-CCA) L79P IV pmn (AAT-GAT) N83D I pmn30 45 (ACT-ACC), 301 (AAA-GAA) K101E I pmn (GAA-GGA) E173G IV pmn6 530 (CTG-CCG) L177P IV pmn (TGC-TAC) C183Y IV pmn (CTT-CCT) L190P II pmn48 82 (TCC-CCC), 493 (TCG-CCG) S28P, S165P IV, IV pmn (TCT-ACT), 193 (AAC-GAC) S37T, N65D IV, I pmn (GCA-GTA), 571 (TTC-CTC) A56V, F191L IV, II pmn (ATG-AAG), 278 (CGC-CAC), M63K, R93H IV, I 285 (CAT-CAC) pmn (AGC-AGA), 290 (GAA-GGA) S73R, E97G II, I pmn (GAT-GGT), 545 (CTG-CCG) D96G, L182P I, IV pmn (CCC-TCC), 254 (GTC-GCC) P72S, V85A II, I pmn21 33 (GAA-GAG), 381 (AAA-AAG), E173G, F191S IV, II 518 (GAA-GGA), 572 (TTC-TCC) pmn27 26 (TTC-TCC), 91 (GCC-ACC), F9S, A31T, L39P IV, IV, II 116 (CTC-CCC), 231 (ATT-ATC) pmn (AAT-TAT), 346 (ATT-GTT), N80Y, I116V, T178A IV, III, IV 532 (ACG-GCG) pdiaa P72A 214, 216 (CCC-GCA) P72A II pdiaa P72S 214, 216 (CCC-TCA) P72S II pdiaa L190A 568, 569 (CTT-GCT) L190A II pdiaa F191L 571 (TTC-CTC) F191L II pdiaa F191S 572 (TTC-TCC) F191S II pdiaa C8S 21, 23 (TTGC-CTCC) C8S IV pdiaa C181S 540, 542 (TTGC-CTCC) C181S IV Results of nucleotide sequencing are summarized. The diaa alleles independently isolated by Mn-PCR and NA26 transformation were encoded on pmn-plasmids. Sequence of mutagenic primers for construction of P72A, P72S, L190A, C8S and 1

2 C181S were 5 -TTTCGAAACGGAGCGGGCAAGCTTACCTGCCATTG, TTTCGAAACGGAGCGGTCAAGCTTACCTGCCATTG, GATCTGATAGATAACACGGCTTTCCCTCACCAGGATGAT, GCAAGAAAGAATTAAAGCCTCCTTCACTGAAAGCATTCAAACTC, and GCATATGCTGACGGTAAACTCCCTGTGCGATCTGATCGATAAC, respectively. Complementary strands were also used. I-IV indicate the position of the mutation sites on the DiaA tertiary structure (see text). I, the dimer-dimer interface. II, the sites essential for DnaA binding. II, the sites nearby the essential DnaA-binding site. III, the putative phosphosugar-binding region. IV, others (protein-internal sites). 2

3 Supplementary Table S2 Eubacterial species that have DiaA homologs Number pf species carrying DiaA type and Phylum Class Order GmhA type DiaA type only Proteobacteria γ Proteobacteria Enterobacteriales 19 0 Pasteurellales 16 0 Aeromonadales 1 0 Vibrionales 13 0 Alteromonadales 3 7 Pseudomonadales 0 17 Oceanospirillales 1 4 Methylococcales 0 1 Legionellales 0 6 Thiotrichales 0 2 Chromatiales 0 4 β Proteobacteria Burkholderiales 3 19 Hydrogenophilales 0 1 Methylophilales 1 0 Neisseriales 1 3 Nitrosomonadales 0 1 Rhodocyclales 0 3 δ Proteobacteria Desulfovibrionales 1 12 Syntrophobacterales 0 2 ε Proteobacteria Campylobacterales 10 6 Chloroflexi Chloroflexi Chloroflexales 1 0 Herpetosiphonales 0 1 Cyanobacteria Chroococcales 1 1 Spirochaetes Spirochaetes Spirochaetales 3 0 Planctomycetes Planctomycetacia Planctomycetales 0 2 Lentisphaerae Lentisphaerales 0 1 Firmicutes Clostridia Clostridiales 0 1 Actinobacteria Actinobacteria Actinomycetales 3 0 Total See the legend for Table 3 on text. 3

4 Keyamura_Fig.S1 Supplementary Figure S1 Supplemental Figure S1 The hydrogen bond network in the DiaA tetramer Close-up view of the hydrogen bond network in the DiaA tetramer. Hydrogen bonds are indicated with pink dashed lines.

5 Supplementary Figure S2 Keyamura_Fig.S2 A S54 (S52) A55 (A53) B Supplemental Figure S2 The sugar binding pocket of Pseudomonous aeruginosa GmhA and the corresponding region in E. coli DiaA (A) A whole structure of a P. aeruginosa GmhA homodimer complexed with D-glycero-Dmannopyranose-7-phosphate (shown as a stick model) (PDB ID 1X92). P. aeruginosa GmhA Ser-54 and Ala-55, which correspond to E. coli DiaA Ser-52 (red) and Ala-53 (blue), are shown as ball-stick model. (B) Close-up view of the sugar binding pocket of GmhA and the corresponding region in DiaA. Each protein surface color depicts a different protomer, and corresponds to that shown in Fig. 1B. In the GmhA structure, D-glycero-D-mannopyranose-7-phosphate (shown as a stick model) is bound to the pocket.

6 Keyamura_Fig.S3 Supplementary Figure S3 biodnaa (40 pmol) DiaA (80 pmol) biodnaa WT WT S52F A53T R71Q (None) N83D L190P P72A P72S K101E DiaA Supplemental Figure S3 Pull down assay of biodnaa and DiaA Wild-type hisdiaa (WT) or DiaA mutants derivatives (S52F, A53T, R71Q, P72A, P72S, N83D, K101E, and L190P) (80 pmol as monomers) were incubated for 5 min on ice in the presence (+) or absence (-) of biodnaa (40 pmol). Pull down assay and analysis of bound proteins were performed as described in the legend for Figure 5A. Non-specific recovery of DiaA proteins was not detected. None, no DiaA was included.