Genes deleted by P335 MLPA kit ** EBF1 ex16, IKZF1, ALL97. CDKN2A, add(12)(p12),add(14)(q32),del(17)(p12), CDKN2B, PAX5,

Transcription

1 Supplementary Table 1 Genetics and FISH results for EBF1-PDGFRB positive patients Patient no. EBF1- PDGFRB fusion detected by RT-PCR 5q33 deletion detected by SNP6.0 Unique ID Trial Karyotype PDGFRB FISH EBF1 FISH Genes deleted by P335 MLPA kit ** EBF1 ex16, IKZF1, ALL97 47,XX,del(6)(q21),+8,add(9)(p13),del(9)(p13), CDKN2A, add(12)(p12),add(14)(q32),del(17)(p12), CDKN2B, PAX5, add(20)(q21)[4]/48,idem,+22[1]/46,xx[15] 1R 0G 1F [55%] 1R 0G 1F [66%] Not Done Not Done BTG ALL97/99 46,XX[30] 1R 0G 1F [56%] 1R 0G 1F [38%] Not Done Yes EBF1 ex16 Complex ALL97/99 46,XX,der(3,13,16)t(3;13)(q1;q1)t(13;16)(q2;p1) rearrangem CDKN2A, del(3)(p2q2),t(3;8)(q2;q2)/46,xx[2] 1R 1G 1F [20%]* 1R 1G 1F [36%]* Not Done ent of 5q CDKN2B ` 7251 UKALL ,XX[20] 1R 0G 1F [82%] 1R 0G 1F [82%] Not Done Not Done EBF1 ex16, PAX UKALL ,XX 1R 1G 1F [45%] 1R 1G 1F [65%] Not Done Normal None UKALL ,XY,add(5)(q3),add(5)(q3),add(9)(p1)[12]/ 46,XY[8] 1R 1G 1F [75%] 1R 1G 1F [55%] Yes Normal IKZF UKALL ,XY[20] 1R 0G 1F [91%] 1R 0G 1F [75%] Yes Yes EBF1 ex16, PAX UKALL ,XY[22] 1R 0G 1F [34%] 1R 0G 1F [40%] Not Done Not Done Not Done UKALL ~48,XX,-8,-16,+2~3mar,inc[cp6]/ ,XX,+10,inc[4]/46,XX[21] 1R 0G 1F [59%] 1R 0G 1F [65%] Yes Yes EBF1 ex16, ETV6 EBF1 ex16, UKALL ,XY,t(9;17)(q1;p1),add(14)(q32), CDKN2A, CDKN2B, add(14)(q32),-20,+mar[21]/46,xy[4] 1R 0G 1F [41%] 1R 0G 1F [68%] Yes Yes PAX5 2R 0G 1F [61%], 2R 0G 1F [48%], UKALL ,XX[20] 1R 0G 1F [14%] 1R 0G 1F [34%] Yes Yes EBF1 ex UKALL ,XX,t(2;12)(p1;p13)[8]/46,XX[2] 1R 0G 1F [79%] 1R 0G 1F [90%] Yes Not Done Not Done UKALL ,XX[20] 1R 0G 1F [33%] 1R 0G 1F [52%] Yes Not Done Not Done 1R 0G 1F [40%], 1R 0G 1F [43%], EBF1 ex16, IKZF1, UKALL ,XX,+5[3]/46,XX[7] 2R 0G 1F [20%] 2R 0G 1F [15%] Yes Yes PAX5, RB UKALL ,XX[20] 1R 1G 1F [67%] 1R 0G 1F [79%] Yes Not Done Not Done 1

2 *FISH studies carried out on relapse sample homozygous deletion **The P335 IKZF1 MLPA kit (MRC Holland, The Netherlands) which contains probes to assess the copy number of EBF1 (4 probes), IKZF1 (8 probes), PAX5 (6 probes in the A1-A4 versions and 7 probes in the B1-B2 versions), CDKN2A/B (3 probes), ETV6 (6 probes), BTG1 (4 probes), RB1 (5 probes), and the PAR1 region: CRLF2, CSF2RA, IL3RA (1 probe each) (see reference 12 ). 2

3 Supplementary Figure 1: CONSORT diagram showing how patients registered on the UK treatment trials: MRC ALL97/99 ( ) UKALL2003 ( ) and ALLR3 ( ), were identified for this study. 3

4 A) MLPA data using the P335 IKZF1 kit was available for 1024/2093 patients entered in to ALL97/99. Full details of the P335 IKZF1 kit and methodology are given in Supplementary Figure 3 and reference 12. *The kit includes 4 probes within the EBF1 gene mapping to exons 1, 10, 14 and 16. Patients showing evidence of loss of exon 16 (probe ratio <0.85) and normal copy numbers for exons 1, 10 and 14 (probe ratio~1.0) were screened by FISH using breakapart probes for PDGFRB and EBF1 for detection of the deletion of 5q33 associated with the EBF1-PDGFRB fusion (Supplementary Figure 3). Two patients tested positive (nos. 1 and 2, shaded grey) B) An unselected cohort of B-other patients (906/3178) entered onto the UKALL2003 treatment trial was screened for rearrangement of PDGFRB by FISH. Patients who tested positive for PDGFRB rearrangement were then tested for rearrangement of EBF1. The cohort was divided into patients who achieved a complete remission (CR) after induction and those who failed induction. Among patients who achieved CR, 8 tested positive for EBF1-PDGFRB rearrangement (nos. 4, 5, 7, 8, 9, 10, 11 and 12). Patients 6 and 13 were identified among patients who failed induction (these positive patients are shaded grey). C) A cohort of 32 B-other patients entered onto the ALLR3 treatment trial for relapsed ALL was screened for rearrangement of PDGFRB by FISH. The 3 patients who tested positive for PDGFRB rearrangement were then tested for rearrangement of EBF1. One patient with EBF1-PDGFRB rearrangement was identified (no. 3, shaded grey). *Non B-other includes all patients with T-ALL, BCP-ALL patients with one of the major cytogenetic abnormalities used for risk stratification; t(12;21)(p13;q22)/etv6-runx1 fusion, high hyperdiploidy (51-65 chromosomes), translocations involving 11q23/MLL rearrangements; t(9;22)(q34;q11)/bcr-abl1 fusion, intrachromosomal amplification of chromosome 21 (iamp21), t(1;19)(q23;p13)/tcf3-pbx1, t(17;19)(q22;p13)/tcf3-hlf fusion, near-haploidy (<30 chromosomes), low hypodiploidy (30-39 chromosomes) and those with no cytogenetic result. Other fusion genes involving PDGFRB or CSF1R were identified during this screen including:, SSBP2-CSF1R, MEF2D-CSF1R and an unknown partner gene in 4 cases, ATF7IP-PDGFRB and SSBP2-CSF1R and ATF7IP-PDGFRB. 4

5 Supplementary Figure 2: Flowchart showing the policy adopted for identification of targetable tyrosine kinase alterations in patients entered on to the UKALL2011 treatment trial from November

6 Patients who failed to achieve remission by the end of induction or have an M2 marrow (5-25% blasts at day 29) or M3 marrow ( 25% blast at day 29) by morphology or are MRD positive at week 14 (>0.5%) are screened for rearrangement of PDGFRB by FISH. So far two patients have tested positive for EBF1-PDGFRB rearrangement (nos. 14 and 15). *Non B-other includes all patients with T-ALL, BCP-ALL patients with one of the major cytogenetic abnormalities used for risk stratification; t(12;21)(p13;q22)/etv6-runx1 fusion, high hyperdiploidy (51-65 chromosomes), translocations involving 11q23/MLL rearrangements; t(9;22)(q34;q11)/bcr-abl1 fusion, intrachromosomal amplification of chromosome 21 (iamp21), t(1;19)(q23;p13)/tcf3-pbx1, t(17;19)(q22;p13)/tcf3-hlf fusion, near-haploidy (<30 chromosomes), and low hypodiploidy (30-39 chromosomes). 6

7 Supplementary Figure 3: FISH probes and signal patterns 7

8 A) Design of PDGFRB dual colour break-apart probe (Cytocell, UK) taken from The probe identifies rearrangement of both PDGFRB and CSF1R. B) Design of in-house EBF1 dual colour break-apart probe C-G) FISH using the PDGFRB and EBF1 break-apart probe on selected cases. C) In patient 1, FISH shows a signal pattern with one red, no green and one red/green fusion signals (1R0G1F), consistent with deletion of 5q33 with breakpoints in PDGFRB and EBF1. D) Patient 3 showed an apparently balanced rearrangement of PDGFRB and EBF1 by FISH with the signal patterns of one red, one green and one fusion signals (1R1G1F), while SNP6.0 analysis revealed of a series of non-consecutive deletions along 5q at diagnosis and relapse (Figure 1). E) Patient 5 showed an apparently balanced rearrangement by FISH, as patient 3 (1R1G1F) with no associated copy number abnormalities of 5q seen by SNP6.0 analysis. F) Patient 11 showed a signal pattern (2R0G1F), consistent with trisomy 5, originating from duplication of del(5)(q33.1q33.3). G) In patient 15, FISH showed a balanced abnormal signal pattern for PDGFRB (1R1G1F) and unbalanced abnormal pattern for EBF1 (1R0G1F). 8

9 Supplementary Figure 4: MLPA and SNP6.0 data A and B) Example of MLPA results confirming loss of exon 16 of EBF1 in patient 14. MLPA was performed using the P335 IKZF1 MLPA kit (MRC Holland, The Netherlands) which contains probes to assess the copy number of EBF1 (4 probes), IKZF1 (8 probes), PAX5 (6 probes in the A1-A4 versions and 7 probes in the B1-B2 versions), CDKN2A/B (3 probes), ETV6 (6 probes), BTG1 (4 probes), RB1 (5 probes), and the PAR1 region: CRLF2, CSF2RA, IL3RA (1 probe each) (see reference 12 ). A) This figure shows the normalised electropherogram trace for patient 15 taken from GeneMarker V1.85 analysis software (SoftGenetics). Relative copy number was obtained after normalisation of peaks against controls. Values between 0.75 and 1.3 were considered to be within the normal range, equivalent to the normal copy number of 2. Values below 0.75 or above 1.3 indicated loss or gain, respectively and a value below 0.25 indicated biallelic loss. These values correspond to copy numbers of 1, 3-4, and 0. Patient results are plotted in blue with the control sample trace in red. The exon names are displayed below their corresponding peaks. B) Table showing the copy number for each exon of 9

10 EBF1 tested by MLPA. C) SNP6.0 microarray copy number heatmap of 6 patients showing deletion of 5q33.1-5q33.3 between EBF1 and PDGFRB (nos. 2, 7, 9, 10 and 14, with Unique patient ID: 4607, 11959, 21347, 21550, 26681, respectively) Patient 11 (Unique ID: 23029) is trisomic for chromosome 5 with two copies of the del(5)(q33.1q33.3) (red=1 copy, grey=2 copies, blue=3 copies) (See Supplementary Table 1). 10

11 Supplementary Figure 5: RT-PCR validation of EBF1-PDGFRB fusion transcript. 11

12 A) RT-PCR was performed on 9 patient samples that harboured the EBF1-PDGFRB rearrangement. Primer sequences were designed to EBF1 exon 14 (cacgagcatgaacggatacggctct) and PDGFRB exon 13 (tttcatcgtggcctgagaatggctc) to identify cases in which the fusion transcript was expressed. GAPDH was used as an endogenous control, as described previously (Roberts et al 5 ). A PCR product was detected in 9 cases, indicating that the fusion transcript is expressed in all cases with a positive FISH result. No product was detected in patient 13 in the first round of PCR but a larger product was detected after a second round of PCR with an extended elongation step (as shown in B) suggesting the breakpoints in this patient are within other exons of EBF1 and PDGFRB. GAPDH appeared to be ubiquitously expressed in all cases. Of the patient samples with a visible product, 4 produced a single band and had sufficient material for Sanger sequencing (nos. 7, 10, 12 and 15). C) Sanger sequencing traces for two cases with the fusion transcript showed EBF1 exon 15 fused to PDGFRB exon 11. The breakpoint was consistent in all sequenced patient samples (n=4). 12