LFH Long- Flanking Homology PCR

Transcription

1 LFH Lng- Flanking Hmlgy PCR igem LMU- Munich 2012 up-fwd up-rev up dwn res 1. PCR genex d-fwd d-rev resistance cassette up-fwd d-rev up dwn 2. Jining-PCR genex Step 1 : Chsing a cassette and designing primers: up fwd abut 1 kb upstream f the gene / regin t be kncked ut (abut nt) up rev within bp dwnstream f the start f the gene t be kncked ut. At the 5 end f this lig add the sequence crrespnding t ne end f the cassette being used frm the fllwing table. The cassette will be amplified with 5 and 3 verhangs that are the same fr every cassette yu use; therefre yu can use mre than ne cassette with ne set f up rev and d fwd primers. d fwd - within bp upstream f the end f the gene t be kncked ut. At the 5 end f this lig add the sequence crrespnding t the ther end f the cassette being used frm the primer table (see abve). d rev abut 1 kb dwnstream f the gene t be kncked ut (abut nt).

2 * If an upstream r dwnstream gene verlaps the gene t be kncked ut the up- rev and d- fwd primers shuld start further within the gene t be kncked ut. Cassette Surce Primers cat kan mls spec tet pgem- cat pdg780 pdg783 pdg647 pdg1726 pdg1727 pdg1513 pdg end f jining primer Up- rev D- fwd CCTATCACCTCAAATGGTTCGCTG CGAGCGCCTACGAGGAATTTGTATCG Step 2: Amplificatin f fragments We use Phusin Plymerase (see Standard PCR). primers (template): up regin: up fwd, up rev (chrmsmal DNA) dwn regin: d fwd, d rev (chrmsmal DNA) cassette: primers and template accrding t the table abve Purify reactin using PCR purificatin kit elute in µl. Determine amunt (Nandrp r agarse gel). Step 3: Jining PCR Using Phusin Plymerase r PCR Extender (if Phusin desn t wrk). Primers up- fwd, d- rev.

3 Master Mix Phusin (50 µl): Stck cncentratin Vlume Final cncentratin Phusin buffer** 5x 10 µl 1x H 2 O - 29,5 µl X µl Y µl - Z µl Primer I (add later; 5µM (5 pml/µl) 4 µl 0,4 µm see the prgramme belw!) Primer II (add later; 5µM (5 pml/µl) 4 µl 0,4 µm see the prgramme belw!) dntps 10 mm 1 µl 200 µm each DNA fragment up - X µl - * DNA fragment d - Y µl - * Cassette - Z µl - * Phusin plymerase 2 U/µl 0,5 µl 0,02 U/µl * ng f each DNA fragment, ng f cassette (It seems t wrk best if yu keep abut a 1:2 rati between flanking regin:cassette). It als wrks well (r even better) t use 10 ng f each DNA fragment and a 3x mlar excess f cassette. ** Tw buffers are prvided with the enzyme: 5x Phusin HF Buffer and 5x Phusin GC buffer. The errr rate f Phusin DNA Plymerase in HF Buffer (4.4x10-7 ) is lwer than that in GC Buffer (9.5x10-7 ). Therefre the HF Buffer shuld be used as the default buffer fr high- fidelity amplificatin. Hwever, the GC Buffer can imprve the perfrmance f Phusin DNA Plymerase n sme difficult r lng templates, i.e. GC- rich templates r thse with cmplex secndary structures. Use f GC Buffer is recmmended fr thse cases where amplificatin with HF Buffer has failed. I Prgramme:

4 98 C 0:30 98 C 0:10 X C 0:30 9x 72 C Y:YY X C annealing temperature Y:YY extensin time. Extensin time depends n amplicn length and cmplexity. Fr lw cmplexity DNA (e.g. plasmid DNA) use extensin time 15 s per 1 kb. Fr high cmplexity genmic DNA 30 s per 1 kb is recmmended. After the prgramme is finished, add primers. II Prgramme: 98 C 0:30 98 C 0:10 X C 0:30 30x 72 C Y:YY + 0:05/cycle 72 C 10:00 15 C Run ~ 5µl f reactins ut n gel, purify remaining 45µl using PCR purificatin kit (very imprtant as buffer cntains detergents!). Master Mix PCR Extender (50 µl): Stck cncentratin Vlume Final cncentratin Phusin buffer** 10x 5 µl 1x H 2 O - 35,5 µl X µl Y µl - Z µl Primer I (add later; 5µM (5 pml/µl) 4 µl 0,4 µm see the prgramme belw!) Primer II (add later; 5µM (5 pml/µl) 4 µl 0,4 µm

5 see the prgramme belw!) dntps 10 mm 1 µl 200 µm each DNA fragment up - X µl - * DNA fragment d - Y µl - * Cassette - Z µl - * Plymerase Mix 5 U/µl 0,5 µl 0,05 U/µl * ng f each DNA fragment, ng f cassette (It seems t wrk best if yu keep abut a 1:2 rati between flanking regin:cassette) ** Fr targets smaller than 2 kb use HighFidelity Buffer. Fr targets ranging between 2 10 kb it is recmmended t try bth buffers and then chse the ne with the best rati f yield t specificity. I Prgramme: 94 C 2:00 94 C 0:20 X C 0:20 9x 72 C Y:YY X C annealing temperature Y:YY extensin time (45 s/kb) After the prgramme is finished, add primers. II Prgramme: 94 C 2:00 94 C 0:20 X C 0:20 30x 72 C Y:YY + 0:05/cycle 72 C 10:00 15 C Run ~ 5 µl f reactins ut n gel (PCR Purificatin nt necessary).

6 Step 4: Transfrmatin Fr Bacillus transfrmatin use µl f (purified) prduct. Fllw the standard Bacillus transfrmatin prcedure. Step 5: Screen clnies fr verificatin (using clny- PCR) See Standard PCR (Taq plymerase fr fragments 1,2 kb, HtStar fr >1,2 kb) Primers: up fwd primer + prper check rev primer d rev primer + prper check fwd primer Cassette Primer # Primer name Lcalizatin Cat Cat check rev 5 - end reverse Cat check fwd 3 - end frward Kan Kan check rev 5 - end reverse Kan check fwd 3 - end frward Mls Mls check rev 5 - end reverse Mls check fwd 3 - end frward Spec Spec check rev 5 - end reverse Speck check fwd 3 - end frward Tet Tet check rev 5 - end reverse Run n gel - shuld give abut 1 kb (depending n the size f yur up and dwn fragments) fragment in psitive clnes and n prduct in negative cntrl. TIPS: When using the Cat r Tet cassette the clnies seem t take abut 2 days t cme up Yu dn t have t use 2 runds f jining PCR (ne withut primers), as described in the riginal prtcl. Hwever, if yu are unable t get prduct with ne rund 2 runds might wrk. Increasing the amunt f cassette template might help if yu dn t get jining prduct.

7 Prtcl generusly prvided by the lab Prf. Thrsten Mascher Grßhadernerstr Planegg-Martinsried