Supplemental Data. Zhang et al. Plant Cell (2014) /tpc

Transcription

1 Supplemental Data. Zhang et al. Plant Cell (214) 1.115/tpc T C N SDIRIP1-GFP Psb 18 - Histone H3 Supplemental Figure 1. Detection of SDIRIP1-GFP in the nuclear fraction by Western blot. SDIRIP1-GFP was transiently expressed in N. benthamiana leaves. T, total protein; C, chloroplastic fraction; N, nuclear fraction extracted from this sample; Psb, chloroplast marker; Histone H3, nuclear protein marker.

2 Supplemental Data. Zhang et al. Plant Cell (214) 1.115/tpc Cytoplasm Cytoplasm Cytoplasm ER Digitonin ER Trypsin ER N Cytoplasm Cytoplasm Cytoplasm ER Digitonin ER Trypsin ER Supplemental Figure 2. The schematic illustration of the principle for FPP assay to reveal C- terminal orientation of SDIR1. () and () Cartoon illustrating two possible results of the FPP assay. Red ball, RFP-HDEL; green ball with line, GFP fused to the C-terminus of SDIR1.

3 SDIR1 H234Y + VC VN(R)- VN(R) + SDIRIP1-VC VN(R)-SDIR1 +VC Supplemental Data. Zhang et al. Plant Cell (214) 1.115/tpc Venus Chloroplast Overlay C Supplemental Figure 3. Controls for ifc assays. Fluorescence images of N. benthamiana leaves transfected with different constructs as labeled. Scale bar, 5 mm.

4 SDIRIP1-MYC-Ubs Supplemental Data. Zhang et al. Plant Cell (214) 1.115/tpc TP + TP min SDIRIP1- MYC Ponceau - MG132 + MG min SDIRIP1- MYC Ponceau C IP with anti-myc W : anti-myc * * 34 - W : anti-ub

5 Supplemental Data. Zhang et al. Plant Cell (214) 1.115/tpc Supplemental Figure 4. SDIRIP1 is unstable and degraded by the 26S proteasome pathway. Total protein extracted from samples transiently expressed in N. benthamiana leaves. () Reactions were incubated at RT with or without 1 mm TP for, 15, 3, and 6 minutes. Samples with high level of SDIRIP1-MYC were used in this reaction. Western blot was performed with anti-myc antibody (top panel). We took a half of each sample before incubation and separated in another gel. Ponceau staining in this gel was used as the loading control (bottom panel). () Reactions were incubated at RT with or without 75 mm MG132 for, 15, 3, and 6 minutes. Samples with low level of SDIRIP1-MYC were used in this reaction. Western blot was performed with anti-myc antibody (top panel). We took a half of each sample before incubation and separated in another gel. Ponceau staining in this gel was used as the loading control (bottom panel). (C) Ubiquitination form of SDIRIP1. The sample was incubated at RT for 15 minutes and then immunoprecipitated by anti-myc antibody at 4 o C. Western blot was performed with anti-myc and anti-ubiquitin antibodies. * indicates IgG heavy chain.

6 SDIRIP1-MYC remaining (%) SDIRIP1-MYC remaining (%) Supplemental Data. Zhang et al. Plant Cell (214) 1.115/tpc CK sdir h SDIRIP1- MYC PG CK h SDIRIP1- MYC PG CK WT sdir Time (h) Time (h) Supplemental Figure 5. The stability of SDIRIP1. () to () Western blot results of one experiment were shown. nti-pg1 (2S proteasome a-subunit G1) was used as the loading control; SDIRIP1-MYC protein level was normalized. Three independent biological repeats were performed and analyzed. Fourteen-day-old seedlings were used in these assays. () Seedlings were pretreated in half-strength MS with or without 1 mm for 3 hours and then incubated in the same medium with 5 mm CHX. Samples were collected, 2, 4, and 6 hours after treatment. Error bars represent SD. () Col-/35S:SDIRIP1-MYC and sdir1-1/35s:sdirip1-myc seedlings were pretreated in half-strength MS, and then incubated in the same medium with 5 mm CHX. Samples were collected, 3, and 6 hours after treatment. Error bars represent SD.

7 SDIRIP1-Ubs Supplemental Data. Zhang et al. Plant Cell (214) 1.115/tpc Ub Supplemental Figure 6. Ubiquitination of SDIRIP1 by SDIR1 in vitro. This assay was carried with (the right lane) or without (the left lane) ubiquitin. Western blot was performed with anti-myc antibody. Three replicates were performed.

8 Cotyledon greening (%) Relative expression level of SDIRIP1 Supplemental Data. Zhang et al. Plant Cell (214) 1.115/tpc Col-/35S:SDIRIP Col-/35S:SDIRIP1 2.1 C Col- Col-/ 35S:SDIRIP1 4.8 Col-/ 35S:SDIRIP1-RNi Col-/35S:SDIRIP Col-/35S:SDIRIP1 2.1 Col-.WT Col-/35S:SDIRIP1-RNi 1.5 Col-/35S:SDIRIP1-RNi (mm) Col-.WT Col-/35S:SDIRIP1-RNi 1.5 Col-/35S:SDIRIP1-RNi 4.8 ½MS 1mM NaCl 125 mm NaCl 15 mm NaCl 1 1 mm mm Supplemental Figure 7. Statistical analysis of rates of germination and cotyledon greening for Col- wildtype, Col-/35S:SDIRIP1, and Col-/35S:SDIRIP1-RNi plants. () Relative expression level of SDIRIP1. Quantitative RT-PCR was performed using ctin7 as the internal control. Expression level of SDIRIP1 in Col- was defined to 1.. Error bars represent SD. sterisks indicate P <.1. () Germination assay. Seeds were grown on half-strength MS medium containing different concentrations of NaCl or. The experiment was repeated for three times. For each repeat, 5 seedlings in each line was used. Error bars represent SD. (C) Cotyledon greening assay. Seeds were grown on half-strength MS medium containing different concentrations of. Cotyledon greening rates were calculated 1 days after stratification. The experiment was repeated for three times. For each repeat, 5 seedlings in each line was used. Error bars represent SD. sterisks indicate P <.1.

9 Weight of 1 seedlings (g) Weight of 1 seedlings (g) Supplemental Data. Zhang et al. Plant Cell (214) 1.115/tpc CK 75 mm NaCl 1 mm NaCl 125 mm NaCl Col-/35S:SDIRIP1 -RNi 4.8 Col-/35S:SDIRIP Col- Col-/35S:SDIRIP1-RNi 4.8 Col- Col-/35S:SDIRIP CK mm NaCl Supplemental Figure 8. Salt treatment of Col- wild-type, Col-/35S:SDIRIP1, and Col-/35S:SDIRIP1-RNi plants in soil. Seeds were stratified in darkness for 4 days at 4 o C and then sowed in soil without or with different concentration of NaCl. () Photographs were taken 24 days after sowing. () Fresh weight of Col- wild-type, Col-/35S:SDIRIP1, and Col-/35S:SDIRIP1-RNi plants from soil growth (CK and 75 mm). The experiment was repeated for three times. For each repeat, 2 seedlings in each line was used. Error bars represent SD. sterisks indicate P <.1.

10 Cotyledon greening (%) Relative expression level of SDIRIP1 Supplemental Data. Zhang et al. Plant Cell (214) 1.115/tpc Col-.WT sdir sdir1-1/35s:sdirip1-rni 8.3 sdir1-1/35s:sdirip1-rni ½ MS mM NaCl.2 sdir1-1 Col-.WT sdir1-1/35s:sdirip1-rni 2 125mM NaCl 2 15mM NaCl 1 1 C Col-.WT sdir1-1 sdir1-1/35s:sdirip1-rni 8.3 sdir1-1/35s:sdirip1-rni (mm) mm mm 7 8 Supplemental Figure 9. Statistical analysis of rates of germination and cotyledon greening for Col- wildtype, sdir1-1, and sdir1-1/35s:sdirip1-rni plants. () Relative expression level of SDIRIP1. ctin7 was used as the internal control. Expression level of SDIRIP1 in sdir1-1 was defined to 1.. Error bars represent SD. sterisks indicate P <.1. () nalysis of germination rates. Seeds were sown on half-strength MS medium containing different concentrations of NaCl or. The experiment was repeated for three times. For each repeat, 5 seedlings in each line was used. Error bars represent SD. (C) nalysis of cotyledon greening rates. The rates were calculated 1 days after stratification. The experiment was repeated for three times. For each repeat, 5 seedlings in each line was used. Error bars represent SD. sterisks indicate P <.1.

11 Cotyledon greening (%) Relative expression level of SDIRIP1 Supplemental Data. Zhang et al. Plant Cell (214) 1.115/tpc C abi5-1 WS.WT abi5-1/35s:sdirip1-rni WS.WT abi5-1 abi5-1/35s:sdirip1-rni 3.3 abi5-1/35s:sdirip1-rni (mm) abi5-1 WS.WT abi5-1/35s:sdirip1-rni 3.3 abi5-1/35s:sdirip1-rni 8.4 ½MS mm mm mM NaCl Supplemental Figure 1. Statistical analysis of rates of germination and cotyledon greening for WS wildtype, abi5-1, and abi5-1/35s:sdirip1-rni plants. () Relative expression level of SDIRIP1 in abi5-1, abi5-1/35s:sdirip1-rni, and WS wild-type plants. ctin7 was used as the internal control. Expression level of SDIRIP1 in abi5 was defined to 1.. Error bars represent SD. sterisks indicate P <.1. () Germination ratio assay. Seeds were sown on half-strength MS medium and half-strength MS medium containing different concentrations of NaCl or. The experiment was repeated for three times. For each repeat, 5 seedlings in each line was used. Error bars represent SD. (C) nalysis of cotyledon greening rates. The rates were calculated 4 days after stratification. The experiment was repeated for three times. For each repeat, 5 seedlings in each line was used. Error bars represent SD. sterisks indicate P <.1.

12 Stomotal aperture Relative leaf weight (%) Supplemental Data. Zhang et al. Plant Cell (214) 1.115/tpc Col-/35S:SDIRIP1-RNi 4.8 Col- Col-/35S:SDIRIP Time (h) mm 5 mm.6.5 (Width/length) Col-/35S:SDIRIP1 -RNi 4.8 Col- Col-/35S:SDIRIP Supplemental Figure 11. SDIRIP1 has no obvious influence on transpiration and effects of on stomotal aperture. () Rosette leaves were excised from 4-day-old plants in soil and weighed at a series of time points. Error bars represent SD. () Ten fresh leaves from Col- wild-type, Col-/35S:SDIRIP1, and Col-/35S:SDIRIP1-RNi plants were incubated in buffer for 3 hours and then treated with 5 mm for 5 hours before measurement. The experiment was repeated for three times. For each repeat, whole aerial parts from1 seedlings in each line was used. Error bars represent SD.

13 Supplemental Data. Zhang et al. Plant Cell (214) 1.115/tpc SDIRIP1-RT-FW 5 -TCGCTCTCCTTGTGT-3 SDIRIP1-RT-Rev 5 -CTCTCGCCGGCGG-3 RFP-RT-FW 5 -TGGCCTCCTCCGGCG-3 RFP-RT-Rev 5 -CGGCGGTGGTGGCG-3 SDIRIP1-qRT-FW 5 - TCCTCCTCCGTCCCTT-3 SDIRIP1-qRT-Rev 5 - GCTCCGGTCCCG-3 F3-qRT-FW 5 - TGGGCGTCGC-3 F3-qRT-Rev 5 - CGCTTGCCTTTTGCT-3 F4-qRT-FW 5 -TTGGTTGCTGTTCG-3 F4-qRT-Rev 5 - CCTCGTTGCCTC-3 I5-qRT-FW 5 - GCCCCGGTTTTTGCCCG-3 I5-qRT-Rev 5 - CCCTCCTCCTTTGTCTCGCTTG -3 ctin7-qrt-fw 5 - TCCTGCCTTCCTCCTC-3 ctin7-qrt-rev 5 - CTCGTCTCCTCTTTGTCCC -3 Supplemental Table 1. Primers used in this work.