Supplemental Information

Transcription

1 FOOT-AND-MOUTH DISEASE VIRUS PROTEIN 2C IS A HEXAMERIC AAA+ PROTEIN WITH A COORDINATED ATP HYDROLYSIS MECHANISM. Trevor R. Sweeney 1, Valentina Cisnetto 1, Daniel Bose 2, Matthew Bailey 3, Jon R. Wilson 3, Xiaodong Zhang 2, Graham J. Belsham, Stephen Curry 1* 1 Biophysics Section, Blackett Laboratory, Division of Cell and Molecular Biology, and 2 Division of Molecular Biosciences, Imperial College London, London SW7 2AZ, UK; 3 Institute of Cancer Research, Chester Beatty Laboratories, Chelsea, London, UK; 4 National Veterinary Institute, Technical University of Denmark, Lindholm Denmark. Supplemental Information Cloning, expression, and purification of GST-FMDV 2C GST-2C constructs were produced in pgex2t (GE Healthcare) which adds a thrombin cleavable N-terminal GST. FMDV 2C cdna for insertion into pgex-2t was amplified using the primers 2C- GSTFd and 2C GSTRev (Table S1). PCR products for insertion into pgex-2t had a 5 BamHI site and an engineered stop codon and EcoRI site at the 3 end. PCR products and pgex2t were digested with BamHI and EcoRI (New England BioLabs) and ligated with T4 ligase (Roche). Cells for expression of GST-2C were grown to an OD 600 of 1 at 37 C and transferred to ice for 5 mins before addition of IPTG (0.1 mm). GST-2C was expressed for 4 hours at 20 C and cells were pelleted a stored at -80 C. GST tagged protein was affinity purified on a GSTrap column (GE Healthcare) using an Äkta FPLC system. GST-2C was further purified by gel filtration on a Superdex S200 10/30 column using an Äkta FPLC system (GE Healthcare) in 50 mm HEPES ph (7.1), 400 mm NaCl, and 1 mm BME. Protein was concentrated to 1 mg/ml and stored at -80 C. Figure S1: Purification of GST-FMDV 2C GST-FMDV 2C was produced in BL21 (DE3) plyss E. coli. a Samples of E. coli proteins pre- and postinduction of GST-FMDV 2C were analysed by 12 % SDS-PAGE. b Following lysis, the soluble protein Supp. Info - Sweeney et al. 1

2 was loaded onto a 1 ml GStrap column (GE Healthcare). After extensive washing in buffer containing 50 mm HEPES, ph 7.1, 400 mm NaCl, 1 mm β-mercaptoethanol, 0.1% Triton X-100 and 20 µg/ml of phenylmethylsulfonyl fluoride, the protein was eluted in wash buffer containing 20 mm glutathione over 10 column volumes. The elution fractions were analysed as shown in the accompanying 12 % SDS- PAGE gel. The lane numbers in the gel correspond to the fraction numbers in the UV absorbance profile. c The affinity-purified protein was concentrated and loaded onto a Superdex S200 size-exclusion column. The elution fractions were analysed as shown in the accompanying 12 % SDS-PAGE gel. The positions of molecular weight standards are indicated. β-amylase is 200 kda, alcohol dehydrogenase is 150 kda, bovine serum albumin is 66 kda, and carbonic anhydrase is 29 kda. d 10 units of thrombin was added per mg of GST-FMDV 2C and incubated for 4 hours at 22 C. Pre (-Thr) and post (+Thr) cleavage samples were analysed by 12 % SDS-PAGE. Figure S2: Effect of cations, temperature, ph and GuaHCl on FMDV 2C ATPase activity The ATPase activity of FMDV 2C(34-318) was measured in 100 µl reactions containing 4 µg protein (1.25 µm), 1 mm ATP and 2 mm MgCl 2, unless otherwise stated. a ATP hydrolysis was measured in the presence of varying concentrations of Mg 2+ (closed circles) or Mn 2+ (open circles). b ATPase activity was measured at the temperatures indicated. c ATPase activity was measured in the presence of 50 mm HEPES buffer prepared over the ph range 6.5 to 8.5. d The ATPase activities of wild type 2C(34-318) and 2C(34-318) M159L were measured in the presence of different concentrations of GuaHCl. Data presented in Fig. 2f is shown here as a percentage of the drug free activity for each protein. Error bars are ± SEM for three experiments. Figure S3: Differential effects of GuaHCl and NaCl on UV cross-linking of ATP to FMDV 2C. UV cross-linking of [α- 32 P]-ATP to FMDV 2C(34-318) in the presence of varying concentrations of a GuaHCl or b NaCl. After cross-linking the protein sample was run on a 12 % SDS-PAGE gel. Top gels the position of protein bands were confirmed by staining with Coomassie before gel drying; Bottom Supp. Info - Sweeney et al. 2

3 gels cross-linked ATP was detected by exposure to a phosphor screen. The intensity of the bands, plotted as a percentage of the no added GuaHCl or NaCl band (solid lines) was measured by densitometry. The effects of GuaHCl and NaCl on the ATPase activity of 2C(34-318) are shown for comparison (dotted lines). Figure S4: FMDV 2C(34-318) binds most tightly to ssrnas that are at least10 bases long. The binding of 2C(34-318) to 32 P end labelled RNA was measured by EMSA. Protein/RNA complexes were separated by native 10% PAGE before being detected by exposure to a phosphor screen. The position of the free unbound probe (Free) and protein/rna complex (Com) is indicated. Varying concentrations of 2C(34-318) (2C) were added to a radiolabelled 7 base long RNA (5 -AUAAUUU) or b radiolabelled 12 base long RNA (5 -CGCGAAUAAUUU). Supp. Info - Sweeney et al. 3

4 Table S1 Primers for amplification and mutation of FMDV 2C sequences Primer Sequence 5 3 2CFLFwd 2C38Fwd 2C34Fwd 2C34Rev 2C61Fwd 2CRev 2CGSTFwd 2CGSTRev 2CK116AFwd 2CK116ARev 2CM159LFwd 2CM159LRev 2CD160AFwd 2CD160ARev 2CN207AFwd 2CN207ARev 2CdHELFwd 2CdHELRev catcatggatccctcaaagcacgtgacatcaacg catcatggatccgagaagtttgtcaccatgacag ctgagaatctttattttcagggaatcgcctctgaagagaagtttgtcaccatgacag ctgtcatggtgacaaacttctcttcagaggcgattccctgaaaataaagattctcag catcatggatccaagtacaaggaagccaaggag catcataagcttactgcttgaagatcgggtgactcg catcatggatccctcaaagcacgtgacatcaacg cagcaggaattctcactgcttgaagatcgggtgactcg cggcaaatctggccagggcgcgagcttccttgcaaacgtg cacgtttgcaaggaagctcgcgccctggccagatttgccg gcaaaccgttgttgtgctggatgatttgggccagaacc ggttctggcccaaatcatccagcacaacaacggtttgc gcaaaccgttgttgtgatggctgatttgggccagaacc ggttctggcccaaatcagccatcacaacaacggtttgc gtcatcatcgccaccaccgccttgtactcgggcttcacc ggtgaagcccgagtacaaggcggtggtggcgatgatgac ctcaagaacggcgaggcggcggccaaagcggccgctgccgctcgagacgcgattaaggcttggatcg cgatccaagccttaatcgcgtctcgagcggcagcggccgctttggccgccgcctcgccgttcttgag Sequences in bold are the restriction sites used for cloning of the PCR fragment into the desired vector. The sequences underlined are the codons mutated using the QuikChange method. Supp. Info - Sweeney et al. 4

5 Figure S1: Sweeney et al. a kda GST2C b kda Peak Fractions Mw Pre Post c GST2C GST2C! kda d kda Product Thr Thr Mw kda UNF Peak Fractions 5

6 Figure S2: Sweeney et al. a b c d 6

7 Figure S3: Sweeney et al. a b mm GuaHCl mm NaCl 7

8 Figure S4: Sweeney et al. a b Com Com Probe Probe !M 2C !M 2C 8