Introduction to DNA microarrays. DTU - January Hanne Jarmer

Transcription

1 Introduction to DNA microarrays DTU - January Hanne Jarmer

2 Microarrays - The Concept Measure the level of transcript from a very large number of genes in one go

3 Microarrays - The Concept Measure the level of transcript from a very large number of genes in one go CELL

4 Microarrays - The Concept Measure the level of transcript from a very large number of genes in one go CELL RNA

5 Microarrays - The Concept Measure the level of transcript from a very large number of genes in one go CELL RNA

6 Why?

7 RNA Why?

8 RNA Why?

9 How? gene mrna gene specific DNA probes labeled target

10 Microarrays - The Technologies Stanford-type Microarrays High-density

11 Stanford-type Microarrays

12 Stanford-type Microarrays

13 Stanford-type Microarrays Coating glass slides

14 Stanford-type Microarrays Coating glass slides Deposition of probes

15 Stanford-type Microarrays Coating glass slides Deposition of probes Post-processing

16 Stanford-type Microarrays Coating glass slides Deposition of probes Post-processing Hybridization

17 Spotting - Mechanical deposition of probes

18 16-pin microarrayer

19

20 Microarrayer

21 Stanford microarrays SAMPLE CONTROL mrna mrna cdna cdna Cy5-cDNA Cy3-cDNA

22 Stanford microarrays SAMPLE CONTROL mrna mrna cdna cdna Cy5-cDNA Cy3-cDNA

23 GeneChip Affymetrix oligonucleotide array

24 GeneChip Affymetrix oligonucleotide array 11 to 20 oligonucleotide probes for each gene On-chip synthesis of 25 mers ~20,000 genes per chip good quality data K features to play with

25 Photolithography in situ synthesis Spacers bound to surface with photolabile protection groups

26 Photolithography in situ synthesis Spacers bound to surface with photolabile protection groups

27 Photolithography in situ synthesis T T T

28 Photolithography in situ synthesis T T T A A A

29 Sample Preparation - Eberwine

30 Sample Preparation - Eberwine SAMPLE

31 Sample Preparation - Eberwine SAMPLE RNA

32 Sample Preparation - Eberwine SAMPLE RNA T7 70 C 10 min

33 Sample Preparation - Eberwine SAMPLE 42 C 2 h + Reverse Transcriptase RNA ssdna T7 70 C 10 min

34 Sample Preparation - Eberwine SAMPLE 42 C 2 h + Reverse Transcriptase RNA ssdna T7 70 C 10 min 16 C 2 h + RNase H + Polymerase dsdna

35 Sample Preparation - Eberwine SAMPLE 42 C 2 h + Reverse Transcriptase RNA ssdna T7 70 C 10 min 16 C 2 h + RNase H + Polymerase clean up dsdna dsdna

36 Sample Preparation - Eberwine SAMPLE 42 C 2 h + Reverse Transcriptase RNA ssdna T7 70 C 10 min 16 C 2 h + RNase H + Polymerase T7 pol dsdna

37 Sample Preparation - Eberwine SAMPLE 42 C 2 h + Reverse Transcriptase RNA ssdna T7 70 C 10 min 16 C 2 h + RNase H + Polymerase T7 pol 37 C 6 h dsdna + Biotin-labeled nucleotides

38 Sample Preparation - Eberwine SAMPLE 42 C 2 h + Reverse Transcriptase RNA ssdna T7 70 C 10 min 16 C 2 h + RNase H + Polymerase T7 pol 37 C 6 h dsdna arna + Biotin-labeled nucleotides

39 Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( )

40 Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( )

41 Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( ) anti-sape IgG

42 Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( ) anti-sape IgG biotinylated anti-anti IgG

43 Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( ) anti-sape IgG biotinylated anti-anti IgG

44 The Affymetrix GeneChip A gene is represented like this: PM MM - Perfect Match (PM) - MisMatch (MM)

45 The Affymetrix GeneChip A gene is represented like this: PM MM - Perfect Match (PM) - MisMatch (MM) PM: CGATCAATTGCACTATGTCATTTCT MM: CGATCAATTGCAGTATGTCATTTCT

46 The Affymetrix GeneChip A gene is represented like this: PM MM - Perfect Match (PM) - MisMatch (MM) PM: CGATCAATTGCACTATGTCATTTCT MM: CGATCAATTGCAGTATGTCATTTCT

47 The Affymetrix GeneChip A gene is represented like this: PM MM - Perfect Match (PM) - MisMatch (MM) PM: CGATCAATTGCACTATGTCATTTCT MM: CGATCAATTGCAGTATGTCATTTCT

48 NimbleGen 385,000 to 2.1 mill features Long probes (up to 70 nt) Service: -labelling -scanning -image analysis

49 Photolithography - Micromirrors

50 Tiling arrays Tiling arrays are used for determation of genes, ncrnas, TF-binding sites,...

51 The DNA Array Analysis Pipeline Question Experimental Design Array design Probe design Sample Preparation Hybridization Buy Chip/Array Image analysis Expression Index Calculation Normalization Comparable Gene Expression Data Statistical Analysis Advanced Data Analysis Clustering PCA Classification Promoter Analysis Meta analysis Regulatory Network