Supplementary Information

Transcription

1 Supplementary Information MicroRNA-212/132 family is required for epithelial stromal interactions necessary for mouse mammary gland development Ahmet Ucar, Vida Vafaizadeh, Hubertus Jarry, Jan Fiedler, Petra AB Klemmt, Thomas Thum, Bernd Groner, Kamal Chowdhury Contents: Page: Supplementary Figures Supplementary Table 1 12 Supplementary Note 13

2 Supplementary Figure 1. Presence of various transcript variants in mir-212/132 genomic locus. (a) The genomic locus of mir-212/132 gene is shown. Sequences encoding the pre-mir structures for the corresponding micrornas are depicted as rectangles in black. Isoform 1 is the previously identified transcript variant based on an EST clone (Genbank Acc.: BY706166) isolated from mouse testis 19. Isoform 2 is the transcript variant we identified by full-length sequencing of another RIKEN EST clone (Genbank Acc.: HM627212) isolated from mouse diencephalon. For both isoforms, the exons are shown as blue rectangles and the introns as the lines extending between the exons. The location of the sequences encoding pre-mir-212 and pre-mir-132 is shown as black rectangles within the second exon. Two of the partially sequenced ESTs (Genbank Acc.: DT and BM933538) are shown as rectangles in green. All drawings are according to the scale and the scale bar for 1 kb sequence is shown. (b) Expression of both transcript variants in different tissues. RT-PCR experiments were performed for adult mouse brain (lane 1), kidney (lane 2), testis (lane 3), heart (lane 4), mammary gland (lane 5), isolated mammary epithelial organoid fraction (lane 6), isolated mammary stromal fraction (lane 7) samples. Negative controls (lane 8) for respective PCR reactions are also shown. Results of RT-PCR for HPRT-1 were shown to indicate the equal amount of cdna being used for all isoform specific PCR reactions. (M) is the 100 bp plus DNA marker. 2

3 Supplementary Figure 2. Generation of mir-212/132 null mice. (a) The targeting strategy and structures of the wild type allele, targeting vector and the targeted allele. pgk-neomycin-pa locus (neo) and thymidine kinase (TK) represents the selection markers. Triangles surrounding the neo cassette are FRT sequences used for the removal of neo cassette in vivo. IRES represents the internal ribosome entry site; and LacZ-pA (LacZ) cassette the reporter gene. The mir-212/132 gene (gray rectangle) and the pre-mir-212 and pre-mir-132 encoding regions (black boxes) are shown. For the representation of the wild type gene structure, we used the structure of isoform 2 shown in Supplementary Figure 1. Location of 5 and 3 hybridization probes (5 P and 3 P) and EcoRI (RI) sites used in southern blot analyses are shown. Sizes of expected DNA fragments for these analyses are depicted for the corresponding genomic regions (not drawn to scale). (b) Southern blot analysis of genomic DNA. Presence of both wild-type and mutant alleles in heterozygous mice and complete absence of wild-type allele in homozygous mutant mice showed the success of targeting. 3

4 Supplementary Figure 3. Whole mount analyses of pubertal and subsequent stages reveal a phenotype only during pubertal ductal outgrowth. Whole mount analyses were done on dissected inguinal (No: 4) mammary glands. Early and late pregnancy samples are from mice on their 10th and 18th day of pregnancy, respectively; lactating samples are from mice sacrificed 1-day after giving birth. MultiPreg samples are from mice sacrificed 5 days after the weaning of pups from their 3rd litters. Proximal distal orientations of all samples are depicted here as left right. The grayscale insets are high-magnification pictures of corresponding samples for detailed visualization. At least 5 mice were analyzed for each genotype at each stage shown. Scale bars represent 1 cm. For grayscale insets, scale bars represent 1 mm. 4

5 Supplementary Figure 4. MiR-212/132 null mice have no defect in circulating estradiol and growth hormone levels. Hormone levels of estradiol (a, b) and Growth hormone (GH) (c, d) were measured in blood samples collected from 7-week-old female littermates. The column graphs (a, c) and the grouped column scatter plots (b, d) for both hormonal measurements are shown. No significant differences were observed between different genotypes for estradiol or growth hormone levels. Data in (a) and (c) are expressed as mean ± s.d. For estradiol measurements: n= 8, 20, and 19 for wild type, heterozygous and homozygous mutant females, respectively. For growth hormone measurements: n= 10, 14, and 12 for wild type, heterozygous and homozygous mutant females, respectively. 5

6 Supplementary Figure 5. Expression kinetics of mir-132 and mir-212 during mammary gland development. Quantitative RT-PCR analyses were performed using wild-type mammary gland samples obtained from mice at different stages of mammary gland development. Pubertal, pregnancy and lactating stages are same as in Figure 2. Expression levels of both mir- 212 and mir-132 gradually increased during pubertal development. Towards the end of the pregnancy, mir-212 and mir-132 expression levels are significantly down-regulated to their lowest levels. After partum, expression levels of both micrornas show a significant up-regulation. Three wild-type mammary gland samples were used for expressional analysis of each stage (n=3). Data is expressed as the mean ± s.d. *, P<0,005; **, P<0,05. 6

7 Supplementary Figure 6. The mir-212/132-/- mammary gland has structural defects in the periductal stroma. Masson s trichrome staining of mammary gland sections from 6-week-old wild-type (a-c) and homozygous mutant (d-f) littermates. Cytoplasm, keratin and intercellular fibers are stained in red; collagen and mucus stained in blue. Sagittal section of a TEB structure (a) shows a fibroblast rich periductal stroma (shown with an arrow) around the neck region. Cross sections of the distal (b) and proximal duct (c) show the periductal stroma containing low and high levels of collagen, respectively (arrows in b,c). Sagittal (d) and cross (e) sections of relatively distal ducts and cross section of very proximal ducts (f) of mutant glands have very little or no collagen in their periductal stroma (arrows in d-f). Mucus-like structures were frequently observed within the ductal lumens of homozygous mutant mammary glands (arrowheads in d-f). Scale bars represent 200 μm for (a) and 100 μm for (b-f). 7

8 Supplementary Figure 7. The deficiency in collagen deposition is caused due to a stromal defect. Masson s trichrome staining of sections from transplants containing homozygous mutant epithelia within wild-type fat pad (a,b) and wild-type epithelia within homozygous mutant fat pad (d,e). The sagital sections of ducts from non-transplanted contralateral glands of wild-type (c) and homozygous mutant (f) mice were shown for comparison. The transplanted mice (n=4 for each set) were sacrificed 7 weeks post-operation and both transplanted and non-transplanted inguinal (No:4) mammary glands were analyzed with Masson s trichrome staining. Cytoplasm, keratin and intercellular fibers are stained in red; collagen and mucus stained in blue, nuclei stained in black. Arrows show the collagen-rich (a-c) and collagen poor (d-f) periductal stroma. Arrowhead in (e) shows the mucus-like staining in ductal lumen. Scale bars represent 100 μm. 8

9 Supplementary Figure 8. MMP-9 is a direct target of both mir-212 and mir-132. a, Alignment of both mir-212 and mir-132 sequences with their target site in the 3 UTR of MMP-9 gene. The seed region of mir-212 and mir-132 is marked together with their binding site. Complimentary nucleotides within the seed region are shown in red. Complimentary nucleotides outside the seed region are shown in blue. The yellow highlighted region shows the mutation generated in the MMP-9 mutant (mut) fragment, in which the dot (.) implies the deletion of the corresponding base. b, Normalized relative luciferase activity in HEK293 cells co-transfected with MMP-9 or MMP-9 mut 3 UTR, and double stranded pre-mir samples for non-targeting control (mir-24), or mir-212, or mir-132, or mir-212 and mir-132 together (n=3, mean ± s.e.m shown). P values are shown for the significance of the differences compared to the non-targeting control groups. 9

10 Supplementary Figure 9. Both CITED1 and Amphiregulin mrna levels are downregulated in mir-212/132 -/- mammary glands. Quantitative RT-PCR results for mammary gland samples obtained from 5-week-old wild-type, heterozygous and homozygous mutant littermates. CITED1 and Amphiregulin mrna levels were determined and normalized against mrna levels of HPRT-1. n=4 for wild-type and heterozygous sample sets, and n=7 for homozygous mutant sample set. Data is expressed as the mean ± s.d. **, P<0,

11 Supplementary Figure 10. MiR-212/132 -/- mammary glands have normal Estrogen Receptor (ER)-alpha expression in both mammary epithelia and stroma. Immunohistochemical detection of ER-alpha expressing cells in the wild-type (a,b) and homozygous mutant (c,d) mammary glands of 6-week-old mice. Arrows show some of the epithelial cells expressing ER-alpha. Arrowheads show the ER-alpha positive stromal cells. Scale bars represent 100 μm. 11

12 Supplementary Table 1. Primer sequences for the detection of different primary transcript variants of the mir-212/132 gene. Primer name Primer sequence (5 -> 3 ) Isoform 1 sense CGGCCCGACAGTCGAGGTATC Isoform 1 antisense CTTCTGCCTCTAGGGTTTTCTGG Isoform 2 sense ACGCGGCCCGACAGCACCTG Isoform 2 antisense GAAGGGGCGTGTGTGGAGCATG 12

13 Supplementary Notes Targeting vector and generation of mir-212/132 -/- mouse lines. The targeting vector (Supplementary Figure 1a) was designed for deleting 953 bp genomic region encompassing pre-microrna sequences of mir-212 and mir-132. It consisted of two homology arms surrounding an internal ribosome entry site (IRES), LacZ-pA reporter, and pgk-neo-pa (Neo) selection cassettes. 5 -homology arm (9.3 kb) extended from the upstream genomic region to the XbaI site in pre-mir-212 encoding sequence; and 3 - homology arm (11.9 kb) contained the downstream sequence starting 618 bp downstream of pre-mir-132 encoding sequence. We used a neomycin resistance cassette (Neo) flanked by two FRT sites in order to be able to delete it subsequently via the Flip-FRT system. A thymidine kinase (TK) negative selection cassette was also inserted. The targeting vector was linearized with PvuI and electroporated into MPI-II embryonic stem (ES) cells. Recombinant ES cells were selected in medium containing G418 and gancyclovir. Successfully targeted clones were identified by southern blot analyses with 5 - and 3 - external probes. ES cells from four of the correct recombinant clones were aggregated with CD1 morulas. Resulting male chimeras were mated to transmit the mutation through the germ line. Removal of the Neo cassette in all cells was performed by mating the mir-212/132 +/- mice with transgenic mouse line that expresses Flip recombinase gene under ROSA promoter in every cell type including germ cells. Neodeleted mir-212/132 +/- mice were then crossed with 129/Sv and C57BL6/N mice to transfer the mutant allele into both genetic backgrounds. At least 6 generations of backcrossing were performed to get mouse lines in almost pure C57BL6/N background. Genotyping was performed by Southern blot or PCR analyses on isolated genomic DNA from tails. 13