SUPPORTING ONLINE MATERIAL

Transcription

1 SUPPORTING ONLINE MATERIAL SUPPLEMENTAL EXPERIMENTAL PROCEDURES Primers for qpcr and semiquantitative PCR and conditions for semiquantitative PCR G6Pase 5 -ttgtggcagaagcatttgag-3, 5 -atatccttgcactggcaacc C 3 min (1 cycle); 94 C 50 sec, 58 C 30 sec, 72 C 30 sec (40 cycles); 72 C 10 min (1 cycle). Expected band size: 541 bp. (A lower molecular weight band obtained with these primers was sequenced and shown to be an alternative splice form of G6Pase). CYP1A4 5'-ggacggaggctgacaaggtg-3', 5'-tgctgcaggatggtggtgag C 3 min (1 cycle); 94 C 50 sec, 59 C 30 sec, 72 C 30 sec (30 cycles); 72 C 10 min (1 cycle). Expected band size: 109 bp. CYP1A5 5 -cttcatgcccttcaccatc-3, 5 -caggccaaaagtcatcac C 3 min (1 cycle); 94 C 50 sec, 56 C 30 sec, 72 C 30 sec (29 cycles); 72 C 10 min (1 cycle). Expected band size: 219 bp. PEPCK 5 -actggtgagcaggggttatg-3 and 5 -tgcatgcaagtgacagatca C 3 min (1 cycle); 94 C 50 sec, 55 C 30 sec, 72 C 30 sec (35 cycles); 72 C 10 min (1 cycle). Expected band size: 182 bp. TiPARP 5 - ccagctccagctccaactac-3, 5 -ctgtaagaacggcatcagca C 3 min (1 cycle); 94 C 50 sec, 57 C 30 sec, 72 C 30 sec (30 cycles); 72 C 10 min (1 cycle). Expected band size: 261 bp. PARP1 5 -gcaggaaaaacagctgaagg-3, 5 -gcatcgctcttgaacacaaa C 3 min (1 cycle); 94 C 50 sec, 54 C 30 sec, 72 C 30 sec (35 cycles); 72 C 10 min (1 cycle). Expected band size: 225 bp. PGC1α 5 -gtgaagaccagcctctttgc-3, 5 tgctgtactggctggagatg C 3 min (1 cycle); 94 C 50 sec, 57 C 30 sec, 72 C 30 sec (35 cycles); 72 C 10 min (1 cycle). Expected band size: 140 bp. SIRT1 5 -tagccaatggtttccactcc -3, 5 -aagaattgtccgtgggtctg C 3 min (1 cycle); 94 C 50 sec, 54 C 30 sec, 72 C 30 sec (33 cycles); 72 C 10 min (1 cycle). Expected band size: 149 bp. AHR 5 -atgaaccccaatgtcacctac-3, 5 -gccatttaatgcctgcagtaag C 3 min (1 cycle); 94 C 50 sec, 56 C 30 sec, 72 C 30 sec (28 cycles); 72 C 10 min (1 cycle). Expected band size: 369 bp. GAPDH 5 -gggtcttatgaccactgtcc-3, 5 -gtaagcttcccattcagctcag C 3 min (1 cycle); 94 C 50 sec, 56 C 30 sec, 72 C 30 sec (27 cycles); 72 C 10 min (1 cycle). Expected band size: 160 bp. β-actin 1

2 5 -gacgagtaaagccatgccaatctcg-3, 5 -ctccattgtccaccgcaaat C 3 min (1 cycle); 94 C 50 sec, 59 C 30 sec, 72 C 30 sec (30 cycles); 72 C 10 min (1 cycle). Expected band size: 110 bp. 18S rrna 5 -gaccataaacgatgccgact-3, 5 -agacaaatcgctccaccaac-3 T annealing, 55 C; these primers were used only for qpcr Expected band size: 288bp. Gene Bank accession numbers for sequences used to design the primers were as follows: G6Pase, XM_422017; CYP1A4, X99453; CYP1A5, X99454; PEPCK, NM_205471; TiPARP, XM_422828; PARP1, NM_205263; PGC1α, NM_ ; SIRT1, NM_ ; AHR, NM_204118; GAPDH, NM_204305; ß-actin, NM_205518; 18S rrna, AF CYP1A4 and 1A5 were used as positive controls for TCDD. GAPDH and β-actin were used as loading controls. All PCR reactions were at cycle number below plateau level. Gene silencing target sequences TiPARP, 5 -gctacgcaactggcttatt-3 ; CYP1A4, 5 -gcatcatctccatcgtcaa-3 ; CYP1A5; 5 -cctcacggaaccatgcaat-3 ; AHR, 5 -gctcttactgcaggcatta-3 ; PGC1α, 5 -ggatgaggatggattgccttcattt-3 and 5 -cagcaaagagaaatgcacctccaaa-3 ; scrambled construct: 5 -gcaatctccatcgttccaa-3. In some experiments for TiPARP silencing SMARTpool dsrna (Dharmacon, Lafayette, CO) was used (5 -ggagatacaccgtgggcaa-3, 5 -gctatgaagttatacgaaa-3, 5 -ggatctgggaccttggata-3, 5 - gccagaaaggcaagctatt-3 ) with sigenome Non-Targeting sirna #3 (Dharmacon, Lafayette CO) as control. Antibodies PGC-1 (H-300) (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, sc-13067, 1:75), acetylatedlysine (Cell Signaling Technology, Beverly, MA, 9441, 1:200-1:750), β-actin (Sigma-Aldrich, Co., St. Louis, MO, A5441, 1:20,000), AHR (Enzo Life Sciences International, Inc., Plymouth Meeting, PA, BML-SA210, 1:1000), SirT1 (Cell Signaling Technology, Beverly, MA, 2028, 1:1500), anti-histone H3 (Sigma-Aldrich, Co., St. Louis, MO, H0164, 1:20,000), anti-acetyl- Histone H3 (Millipore Corporation, Temecula, CA, , 1:20,000), anti-par (Trevigen, Inc., Gaithersburg, MD, 4336-BPC-100, 1:1000). Antisera for CYP1A4 (1:1000), CYP1A5 (1:2000) and CYP1A4/1A5 (1:5000) were produced from purified CYP1A4 and 1A5 as reported (Kanetoshi A et al. Mol. Pharmacol (1992)). Primers for ChIP assay CYP1A5: Forward- 5 -gccctatctggcagctc-3 Reverse- 5 -gcaggacctctggcctca-3 TiPARP: Forward - 5 -gcggcactgagataggaaga-3 Reverse - 5- catgtgctcacacagacagc-3 PEPCK-1: Forward - 5 -atcttggccttgatttgcat-3 Reverse - 5 -gccaccaacacacagtaagc-3 PEPCK-2 Forward - 5 -gtaagaagaggcccccagtc-3 Reverse 5 -tacaggagctcggttgtggt-3 2

3 SUPPLEMENTAL FIGURE LEGENDS FIGURE S1. Effects of TCDD in CEH at 90 min, 3 h and 6 h after treatment. CEH maintained in culture for 24 h were treated with TCDD or dioxane (C). TCDD effects on expression of PEPCK, TiPARP and CYP1A4 by qpcr (A), Glucose output (B) and NAD + levels (C). FIGURE S2. CYP1A does not participate in the suppression of glucose output by TCDD. A, western blots with monospecific anti-cyp1a4 or CYP1A5 IgG on lysates from CEH transfected with sirna for CYP1A4 (top panel) or CYP1A5 (bottom panel), chick orthologs of mammalian CYP1A1 and 1A2, respectively, or a scrambled sirna (scr). CEH were kept overnight after transfection and then treated for 24 h with TCDD (T) or dioxane (C). Bar graphs on the right show mean relative densitometry units (RDU) ± SE. B, Glucose output in CEH treated as described in A. FIGURE S3. NAM does not increase glucose output by an osmotic effect. CEH were treated with TCDD or dioxane (C) with or without NAM (50 mm) or mannitol (50 mm) as an osmotic control for 24 h. Effect on glucose output was measured as described in Experimental Procedures. FIGURE S4. NAM increases hepatic glucose output and NAD + levels after treatment in vivo. Sixteen day old chick embryos were treated in ovo with TCDD or dioxane (C) for 24 h, with and without NAM at 50 mg per egg. Glucose output was measured in hepatocytes immediately after isolation from livers of the chick embryos treated in ovo. NAD + levels were measured in the liver homogenates. Data shown for glucose output are for hepatocytes from 3 groups of 3 livers per treatment, and for NAD + from 3 groups of 2 livers per treatment. FIGURE S5. Effects of TCDD and NAM in mammalian (rat) H4IIE cells. A, Effect of TCDD or dioxane (C) treatment with and without NAM for 24 h (1 nm TCDD and 50 mm NAM) on glucose output (n = 4 cell preparations for each treatment). B, Western blots for AHR, CYP1A1, and β-actin in H4IIE lysates treated as in A (upper panels) with bar graphs for mean densitometry units + SE below, for AHR (lower left bar graph) and for CYP1A1 (lower right bar graph). FIGURE S6. TCDD impairs SIRT1 levels and function. A, Effects of TCDD (24 h) and dioxane (C) on SIRT1 expression and protein levels. Left panel, semiquantitative PCR results for SIRT1 expression in CEH with GAPDH as a loading control; Right panel, Western blots for SIRT1 and β actin using lysates from CEH transfected with pad-track Flag-SIRT1 (8438, Addgene), with bar graphs showing mean densitometry units + SE below. B, Western blots for acetyl-histone H3 (acetyl-h3) and total Histone H3 using lysates from CEH co-treated with TCDD or dioxane (C) for 24 h and the classi/ii histone deacetylase inhibitor trichostatin A (TSA, 30 μm) with and without NAM (50 mm). Dotted lines denote deletion of irrelevant lanes in the same blot. The fraction of acetyl H3/total H3 + SE are shown in the bar graphs based on densitometry readings (RDU) of the immunoblots. 3

4

5

6

7

8

9