APPENDIX I. A. Media compositions LB medium: Tryptone-10g Yeast extract-5g NaCl- 10g ph-7 Distilled water- 1L. YEM medium :
|
|
- Della Walton
- 5 years ago
- Views:
Transcription
1 APPENDIX I A. Media compositions LB medium: Tryptone-10g Yeast extract-5g NaCl- 10g ph-7 Distilled water- 1L YEM medium : Mannitol- 10g KH 2 PO 4-200mg K 2 HPO 4-200mg Yeast extract- 1g MgSO 4 (1M)- 800 µl CaCl 2 (1M)- 400 µl Agar - 18g Distilled water 1L B. 2% Cetyl triamonium bromide (CTAB)buffer : 2% CTAB 1.4M NaCl 100mM Tris-HCl 20mM EDTA C. MS medium : Components mg/lit Stock Preparation & stock needed to prepare 1L media Macro Nutrients MgSO 4.7H 2 O X/500ml (50ml/lit) CaCl 2. 2H 2 O 440 KNO NH 4 NO KH 2 PO Micro Nutrients MnSO 4.4H 2 O X/500ml (5ml/lit) ZnSO 4.5H 2 O 8.6 CUSO 4.5H 2 O CoCl 2.6H 2 O H 3 BO 3 6.2
2 Na 2 MbO 4.2H 2 O 0.25 KI 0.83 Iron FeSO 4.7H 2 O X/250ml (2.5ml/lit) Na 2 EDTA Vitamins Nicotinic Acid X/100ml (1ml/lit) Pyridoxine HCl 0.5 Thiamine HCl 0.1 Glycine 2 Myoinositol 100 Sucrose 30g ph 5.8 Agar 0.8%
3 D. Arabidopsis downstream genes and the cis motifs present in their promoters up to 1Kb upstream from ATG codon analysed by STIF Database. Gene name RD29A W-box(T)TGAC[C/T] Start site- end site G-box, CACGTG Start site- end site - RD ADH LTP KIN1 - LEA P5CS 'UTR P5CS COR RAB RD29B - - FSD APX CZSOD2 - - NAC ICE The genes analysed by RT-PCR were : AtbHLH17 (AT2G46510), AtWRKY28 (AT4G18170) RD29A (AT5G52310), RD22 (AT5G25610), ADH1 (AT1G77120), LTP4 (AT5G59310), KIN1 (AT5G15960), LEA14 (AT1G01470), P5CS1 (AT2G39800), COR47 (AT1G20440), RAB18 (AT5G66400), RD29B (AT5G52300), FSD2 (AT5G51100), APX6 (AT4G32320), CZSOD2 (AT5G52300).
4 APPENDIX II Vectors used in the study A. Circular map of vector ptz57r/t (T-vector). The ptz57r/t vector was obtained from MBI Fermentas. The PCR amplified products were prepared with A overhang and cloned into the ptz57r/t vectors adopting manufacturers protocols (MBI Fermentas, Hanover, MD, USA). B. Circular map of prt101 vector. The cloning vector prt101 with CaMV35S promoter and polya terminator was used in the study.
5 C. Circular map of λ ZAP vector. The AtWRKY28 cdna cloned in λ ZAP vector was obtained from RIKEN Genomic Sciences Center(GSC), Plant Funtional Genomics Research Group (PFG), JAPAN. D. Circular map of λ FLC-1-B vector. The AtbHLH17 cdna cloned in λ FLC-1-B vector was obtained from RIKEN Genomic Sciences Center(GSC).Plant Funtional Genomics Research Group(PFG),JAPAN.
6 E. Schematic map of the T-DNA region of pbe2113 CaMV35S::GUS. F. Schematic representation of the CaMV35S::EcNAC1 cassette in pgreen vector.
7 R/R2/R Gene cdna UBI nos 3 BstXI (10782) CaMV35S promoter hygromycin (R) XhoI (8901) CaMV35S polya T-Border (left) kanamycin (R) Hind III (11076) SphI (11074) PstI (11068) SalI (11058) XbaI (11052) BamH I (11046) SmaI (11043) KpnI (11041) SacI (11035) EcoR I (11025) XhoI (9995) SacII (8383) lacz alpha CaMV 35S promoter Gus first exon NcoI (1) Catalase intron BglII (8) Gus second exon pcambia1301 pb4nu bp NheI (2014) Histidine tag BstEII (2050) Nos poly-a T-Border (right) SphI (2455) pvs1 sta pbr322 ori pbr322 bom Nhe I (5458) pvs1 rep G. Circular map of the pb4nu vector. The binary vector pb4nu with ubiquitin promoter and nos terminator was used in the study. H. Circular map of the impact vector 1.1. The cloning vector impact vector 1.1 with Rbcs promoter and Rbcs terminator was used in the study.
8 I. Circular map of the pbinplus vector. The binary vector pbinplus with kanamycin plant selectable marker was used in the study.
9 PacI (26 56 ) XhoI (2646 ) ApaI (26 45) SfiI (2640) SfiI (26 31) HindIII (2618) SalI (2606 ) Asc I (2599 ) SmaI (2596 ) XmaI (2594 ) BamH I (2590) EcoRV (2586) XbaI (2580) KpnI (2567) attl4 PstI (103) EcoRV (116 ) M13 Reverse Primer Binding Site SacI (2561) EcoRI (2551) attl1 ApaI (24 46 ) M13 Forward (-20) primer binding site M13 Forward (-40) primer binding site rrnb T1 transcription terminator rrnb T2 transcription terminator pgate L1-L bp Km(R) f1 origin J. Circular map of the pgatel1l4 vector. The entry vector pgatel1l4 with multiple cloning sites between attl1 and attl4 was used in the study. Vector map drawn using VNTI tool (Invitrogen USA). attl: recombination sites.
10 PacI (2765) XhoI (2755) ApaI (2754) SfiI (2749) SfiI (2740) HindIII (2727) SphI (2725) SalI (2715) AscI (2708) SmaI (2705) XmaI (2703) BamHI (2699) EcoRV (2695) XbaI (2689) KpnI (2676) SacI (2670) attr3 PstI (155) NotI (159) EcoRV (168) M13 Reverse primer binding site EcoRI (2660) attr4 ApaI (2498) M13 Forward (-20) primer binding site M13 Forward (-40) primer binding site rrnb T1 transcription terminator rrnb T2 transcription terminator pgate r4-r bp Km(R) ApaLI (1611) f1 origin K. Circular map of the pgater4r3 vector. The entry vector pgater4r3 with multiple cloning sites between attr4 and attr3 was used in the study. Vector map drawn using VNTI tool (Invitrogen USA). attr: recombination sites.
11 PacI (2652) AvaI (2642) XhoI (2642) ApaI (2641) SfiI (2636) SfiI (2627) HindIII (2614) Sph I (2612) Sal I (2602) Asc I (2595) Sma I (2592) AvaI (2590) XmaI (2590) BamHI (2586) EcoRV (2582) XbaI (2576) KpnI (2563) Sac I (2557) attl2 PstI (103) NotI (107) EcoRV (116) M13 Reverse primer binding site EcoRI (2547) attl3 ApaI (2446) AvaI (2439) M13 Forward (-20) primer binding site M13 Forward (-40) primer binding site rrnb T1 transcription terminator rrnb T2 transcription terminator ApaLI (1559) f1 origin pgate L3-L bp Km(R) L. Circular map of the pgatel3l2 vector. The entry vector pgatel3l2 with multiple cloning sites between attl3 and attl2 was used in the study. Vector map drawn using VNTI tool (Invitrogen USA). attl: recombination sites. \
12 M. Circular map of the pkm12gw vector. The binary vector pkm12gw with attr1 and attr2 sites and kanamycin plant selectable marker was used in the study. Vector map drawn using VNTI tool (Invitrogen USA). ccdb: negative selection marker; CmR: Chloramphenicol; attr: recombination sites.
13 APPENDIX III Details of primers used in the study Primer name Sequence 5-3 A. M13 universal primers M13 F gtaaaacgacggccagt M13 R caggaaacagctatggac B. Primers used for Arabidopsis transgenics analysis AtbHLHfp ccatgggacttttctagttgca AtbHLHrp ggggtaccttatttgattttctaaag AtbHLH rt fp cagtagaagaaagtccagaagttgac AtbHLH rt rp gtcaatggatccgacccgttgttag AtWRKY28fp ctcgaggcaccaatctagacctc AtWRKY28rp ccatggttttttctctacctctctc AtWRKY28 rtfp gtacaacacaaaagtgcaacgtgaag AtWRKY28 rtrp ccgccgttagtataagctgccgtc GUS fp tatgttacgtcctgtagaaacccc GUS rp cattgtttgcctccctgctgcg GUSrt fp cagcgccgtcgtcggtgaacag GUSrt rp cattgtttgcctccctgctgcg NptIIfp gaggctattcggctatgactg NptII rp atcgcgaggggcgataccgta Actin-F tccataatgaagtgtgatgt Actin-R ggacctgactcgtcatactc ADH1 rtfp gacaggagtgtggaatgcaccg ADH1 rtrp gaatttctcaagctccagctcc AtAPX6 FP gagcttgttgccttatctgg AtAPX6 RP ggtcttctgcataccgtttcacc COR47 rtfp gaagctcccaggacaccacg COR47 rtrp cgttacaaccaacggcgtggacg CZSOD2rtFP ctcaggtcctacaactgtgaatgttc CZSOD2rtRP ctgccacgccatcggcattgg FSD2 rtfp ggacatggcttgcatataaggcg FSD2 rtrp ggattccaaccttgtgcttacag KIN1 rtfp gccttccaagccggtcaga KIN1 rtrp ctcccaaatttgacccgaatc LEA14 rtfp gtcattcgattccgatctgtgagatc LEA14 rtrp ccctacaacaggaaggtcgatgg LTP4 rtfp gttgaacggtatggctcaaac LTP4 rtrp ccatactcttcaggcaaatgatgtc P5CS1 rtfp ggtgctatagatcacattcacc P5CS1 rtrp ccatctcgttgtaagtaatccttcg RAB18 rtfp ctagctcggaggatgatggac RAB18 rtrp cgaagcttaacggccaccac RD22 rtfp gaggtggctaagaagaacgcac RD22 rtrp gttccaagctgaggtgttcttg RD29A rtfp gcgagaagtgatgatgtggaag RD29A rtrp ctcccaccggaatttctccgg RD29B rtfp caacggtgatgacaaagctac RD29B rtrp ctcaaccgtcacttccacctc
14 C. Primers used for amplifying fingermillet TFs, expression analysis and tobacco transgenic analysis ragibzipfp ggagacaaagagcaagtatttggag ragibziprp gggttttttgcatataatcgaag EcbZIPRP2 gctgtgggagcaccaacaggcc EcbZIPFL FP aatatcccaatcgagctacatggacgcg EcbzipFLrev1 ggttttttgcatataatcgaagatttatag Ecbzipcd1F catggacgcggacttcttcgc Ecbzipcd1R cctagcctaacaagctgctgc EcbZIPRT fp ctaatgcccggtctacccaacc EcbZIPRT rp gctgcagcatgaaacggtaagg EcMYCFP1 gaatccccaattcccgacgcggcag EcMYCRP1 gcatgctttgtgcttggttgagcaccgc EcMYCFP2 gcatgccgagagaagattagaag EcMYCRP1 gattttatttactaataatatacaacggtg EcMycCDS F atgacctcctcggagggctcccagtgg EcMycCDS R cctctttccaaaagatcaggcaactggc EcMYC RT f agagttgaaggctgaaaagaatgag EcMYCRT R ccacatcggaaatccagggtag EcNAC fl F agcagtcgaggggagcgagc EcNAC fl R gactccatgtacgctacgccg EcNAC cds F caggatccatgaccatgggaggaggg EcNAC cds R cctagaattctgtatttacagaggtcgc EcNAC rt F cgagtaccgtcttgctgatgcc EcNAC rt R cgagtgcgagtgcgagttcc Hpt II F agctgcgccgatggtttctac Hpt II R atcgcctcgctccagtcaatg D. Primers used for downstream expression analysis in tobacco transgenics NtCCD1B rtfp gaatcttcgaccttggacctgg NtCCD1B rtrp ctctgtgacaaagaaggcatgg NtCHl a-b rt FP gatcaaggagttgaggacaaag NtCHl a-b rt RP gatcttcagagtctcactccaac NtMgProtpor rtfp gtccagggatgaagctcgcc NtMgProtpor rtrp gtctcatcctggcaccagtctc NtBIP1 rtfp gaacgtatggtcaaggaggccg NtBIP1 rtrp ctcagcactctggttgtcgtcc NtCRT1 rtfp cattcccaacccggagtacaag NtCRT1 rtrp cttggcatactctggatcgtc NtPDIL1 rtfp gtgctgttggagttctatgcac NtPDIL1 rtrp gtgacaagttaccggaggcag NtUbi E2 rtfp ctatagcaacgggcacatct NtUbi E2 rtrp ctcaagggtcagatggacacc NtNCX rtfp gttcttcacttgagggactatc NtNCX rtfp gtaattccagccactacactcg NtLEW1FP ggtcctgtgagatgtcacatggg NtLEW1RP gacgaagctgactgcatgttg NtGID1FP gtctgcccgctgccatggacg NtGID1RP ccgtactctaaccggcgccagctc NtSLR1rt F cggtcaagtactgaaacagaagtg NtSLR1rt R gtaatgcctcgttaaacctgtcc NtSUB1ArtF gatcagcccacacgttctgac NtSUB1ArtR gacgatccctgagtctggctc NTRD29AF tcggtgtaccaacaggcata NTRD29AR cccttgctttggtgttgttt NtLTP1F atgctgcagtgggattaagg NtLTP1R agcagtcaatggaagggcta NtLEA14F ctccgttcccgtacctatca NtLEA14R caatctgcgccaatatcctt NtP5CS F tggcactctctttcatcgtg NtP5CS R agcttcattttcagccagga Ntrd29B F tcggtgtaccaacaggcata Ntrd29B R cccttgctttggtgttgttt NtPP2CF agccgatgcatacagccatacaga NtPP2CR caaacgcacgggaaacagcaagta NtERD1F gccatgcatgaagtgatcttggca NtERD1R acaaatggctgcaacagcctcatc