Polymorphism [Greek: poly=many, morph=form]

Transcription

1 Dr. Walter Salzburger The Neutral Theory The Neutral Theory 2 Polymorphism [Greek: poly=many, morph=form] images:

2 The Neutral Theory 3 Polymorphism!...can be defined as the existence of two or more forms within the same population (or the same species)! the persistence of polymorphism within a species (just as evolutionary change between species) can be explained by:! natural selection! drift The Neutral Theory 4 Genetic Drift! random changes in gene frequencies in a population computer simulation of the Wright-Fisher model of random genetic drift (from: Hartl, 1997)

3 The Neutral Theory 5 The Neutral Theory! The Neutral Theory of Molecular Evolution was formalized in the 1960s by M. Kimura! The Neutral Theory deals with the relative importance of natural selection and random drift in molecular evolution Motoo Kimura ( )! The Neutral Theory became - in modifications - a null model of molecular evolution The Neutral Theory 6 The Neutral Theory!...states that the majority of molecular evolution is driven by neutral drift (which does not mean that the majority of mutations are neutral!)! Natural selection is needed to explain adaptation. Yet, evolution at the DNA level is - according to the neutralists - primarily non-adaptive! opposite view: molecular evolution is driven by natural selection

4 The Neutral Theory 7 selectionist neutralist pan-neutralist frequency of mutations frequency of mutations frequency of mutations selection coefficient selection coefficient of a mutation: + mutation increases in frequency - mutation is eliminated 0 gene frequencies drift The Neutral Theory 8 The Neutral Theory: evidence! The rate of molecular evolution and the degree of polymorphism is too high to by explained by natural selection! The constancy of molecular evolution ( molecular clock ) seems to be inconsistent with natural selection! Functionally less constrained parts evolve at higher rate (which is the opposite of what a purely selectionist s view would predict)

5 The Neutral Theory 9 The Neutral Theory: evidence Species Number of loci P(%) H(%) Phlox cuspicata ,2 Limulus polypemus ,7 Homarus americanus ,8 Gryllus bimaculatus ,3 Drosophila robusta Bombus americanorum Bufo americanus ,7 Homo sapiens ,7 Nevo (1988) Variation measured as percentage of polymorphic loci (P) and average heterozygosity per individual (H) The Neutral Theory 10 The Neutral Theory: evidence Nucleotide substitutions horse/ donkey goat/ cow llama/ cow rabbit/ rodent pig/ cow dog/ cow horse/ cow human/ cow human/ kangaroo human/ rodent sheep/ cow Millions of years ago Kimura (1993)

6 The Neutral Theory 11 The Neutral Theory: problems! Levels of heterozygosity are too constant between different species! The molecular clock is not constant enough, and there are genes not following a clock-like behavior! Genetic variation and evolutionary rates are not always related as predicted The Neutral Theory 12 The Nearly Neutral Theory!!...is a modified version of the purely neutral theory (developed by Ohta in the 1990s)!...allows nearly neutral mutations such as slightly disadvantageous mutations. These behave neutrally in small populations but not in large ones (this is why genetic variation in large populations is somewhat smaller than predicted by the neutral theory)!...can in principle account of what is known about molecular evolution

7 The Neutral Theory 13 DNA sequence evolution non-coding segment (control region) T. moorii ATGAATGGTGATAAGATATTGATA N. brichardi ATGAGTGATAATGGAATAT-AATA O. tanganicae! ATGAATGATATTAAGATATTGATA ----*--*-**-***----**--- protein coding segment (ND2 gene) T. moorii ATTCTACTCTCCCTAGGAGGCCTC N. brichardi ATTCTCCTCTCACTGGGGGGCCTC O. tanganicae! ATTCTCCTTTCACTGGGAGGCCTC -----*--*--*--*--* The Neutral Theory 14 DNA sequence evolution

8 The Neutral Theory 15 DNA sequence evolution non-synonymous substitution original DNA sequence...ccgctcgtcagctag... Gly Glu Gln Ser Ile...CCGCTCGTCAACTAG... Gly Glu Gln Leu Ile...CCGCTTGTCAACTAG... Gly Glu Gln Leu Ile synonymous substitution The Neutral Theory 16 dn/ds ratio! dn/ds (Ka/Ks) provides information about the form of sequence evolution in a gene*:! dn/ds < 1: purifying selection (non-synonymous sites are evolving slower than synonymous sites)! dn/ds = 1: neutrality (non-synonymous and synonymous sites are evolving at equal rates)! dn/ds > 1: positive selection (non-synonymous sites are evolving faster than synonymous sites; natural selection has acted to change the amino acid sequence) *ds is used as proxy for the neutral rate of molecular evolution

9 The Neutral Theory 17 Pancreatic ribonuclease in colobine monkeys Zhang et al. (2002) douc langur The Neutral Theory 18 Pancreatic ribonuclease in colobine monkeys Ka = substitutions per non-synonymous sites Ks = substitutions per synonymous sites (and non-coding sites) douc langur Ka/Ks = 4.026

10 The Neutral Theory 19 Pancreatic ribonuclease in colobine monkeys Zhang et al. (2002) douc langur adaptation to different ph in the colobine small intestine The Neutral Theory 20 Pancreatic ribonuclease in leaf-eating monkeys douc langur Prud homme & Carroll (2006) guereza

11 The Neutral Theory 21 Pancreatic ribonuclease in leaf-eating monkeys douc langur Zhang (2006) guereza The Neutral Theory 22 Tests for positive selection! HKA test (Hudson, Kreitman and Aguade 1987):! compares the level of polymorphism in two nuclear loci to test for neutral versus adaptive sequence evolution! McDonald-Kreitman (1991) test:! uses fixed and polymorphic sites to test for neutral versus adaptive sequence evolution

12 The Neutral Theory 23 Tests for positive selection: McDonald-Kreitman species A Ind. 1 A T GACTTGAT Ind. 2 A T GACTTRAT Ind. 3 A T GACTTAAT Ind. 4 A T GACTTAAT species B Ind. 1 A C GACTTGAT Ind. 2 A C GACTTAAC Ind. 3 A C GACTTGAT Ind. 4 A C GACTTGAY fixed site polymorphic site The Neutral Theory 24 Tests for positive selection: McDonald-Kreitman Alcohol dehydrogenase gene (adh) in Drosophila D. melanogaster (12) D. simulans (6) D. yakuba (24)

13 The Neutral Theory 25 Tests for positive selection: McDonald-Kreitman Differences Fixed sites Polymorphic sites Total synonymous SF = 17 SP = 42 SF + SP = 59 non-synonymous NF = 7 NP = 2 NF + NP = 9 Sum SF + NF = 24 SP + NP = McDonald & Kreitman (1991) The Neutral Theory 26 Tests for positive selection: McDonald-Kreitman NF/SF = 7/17 = 0.41 fixed non-synonymous/fixed synonymous sites NP/SP = 2/42 = polymorphic non-synonymous/polymorphic synonymous sites NF/SF is significantly higher than NP/SP Fisher s exact test: P = McDonald & Kreitman (1991)

14 The Neutral Theory 27 Sliding Window Analysis! Why?! sequence evolution might not be the same over the entire locus sequence dn/ds sequence length The Neutral Theory 28 Sliding Window Analysis SIV envelope (env) protein Demma et al. (2006)

15 The Neutral Theory 29 Testing Neutral Evolution: Tajima s D S... number of segregating sites is the amount of polymorphic nucleotide sites in the dataset!... average pairwise difference is the average of all pairwise differences in the dataset The Neutral Theory 30 Testing Neutral Evolution: Tajima s D segregating sites and average pairwise differences TaxonA A T GGCAGTCT TaxonB A C GGCAGTCT S = 1! = 0.1

16 The Neutral Theory 30 Testing Neutral Evolution: Tajima s D segregating sites and average pairwise differences TaxonA A T GGCAGTC T TaxonB A C GGCAGTCT S = 2 TaxonC A T GGCAGTTT! = 0.13 The Neutral Theory 30 Testing Neutral Evolution: Tajima s D segregating sites and average pairwise differences TaxonA A T GGCA GTC T TaxonB A C GGCAGTCT S = 3 TaxonC A T GGCAGTTT! = 0.15 TaxonD A T GGCG GTC T

17 The Neutral Theory 31 Testing Neutral Evolution: Tajima s D " = 4N# mutation rate genetic variation (theta) effective population size...can be estimated using the proportion of segregating sites or the average pairwise differences The Neutral Theory 32 Testing Neutral Evolution: Tajima s D theta estimated from segregating sites D = " (!) - " (S) theta estimated from average genetic diversity

18 The Neutral Theory 33 Testing Neutral Evolution: Tajima s D bottleneck, selective sweep neutral evolution balancing selection, sub-division D < 0 D " 0 D > 0 The Neutral Theory 34 Selective sweep & genetic hitch-hiking beneficial mutation hitch-hikers S1!1 S1 > S2!1 >>>!2 S2!2

19 The Neutral Theory 35 Selective sweep & genetic hitch-hiking nucleotide diversity (!) distance (kb) beneficial allele