High-Resolution Melting Interactive Workshop AACC, July 25 th, 2006 Assay Description

Transcription

1 AACC, July 25 th, 2006 Assay Description List of Example Assays Page Technique Example assay 2 Unlabeled probe genotyping HR-1 Factor V Leiden mutation 6 Unlabeled probe genotyping - LightScanner Factor V Leiden mutation 10 Whole amplicon genotyping β-globin (HbS, HbC mutations) 14 Multiplex genotyping by whole amplicon and HFE (hemochromatosis) unlabeled probe analysis 19 DNA matching HLA DRß1 22 Mutation scanning demo 5 -UTR hepatic lipase 25 Mutation scanning 5 -UTR hepatic lipase 28 Allele fraction sensitivity Genomic C/G SNP

2 Technique: Gene target: Unlabeled probe genotyping HR-1 Factor V Leiden: Detection of a G>A SNP, important in coagulation predisposition Goal: Correctly identify the genotype of an unknown sample by comparing melting curves with samples of known genotypes. Assay diagram: amplicon size (100 bp) Probe Forward primer p-tggacataaggagcggacaggt5 5 CTGAAAGGTTACTTCAAGGACAAAATACCTGTATTCCTCGCCTGTCCAGGGATCTGCTCTTACAGATTAGAAGTAGTCCTATTAGCCCAGAGGCGATGTC 3 GAGTTTCCAATGAAGTTCATGTTTTATGGAGATAAGGAGCGGACAGGTCCCTAGACGAGAATGTCTAATCTTCATCAGGATAATCGGGTCTCCGCTACAG Reverse primer PCR protocol: Human genomic DNA samples of different Factor V Leiden genotypes were amplified in an Roche LightCycler using 10 μl reaction volumes, including: Cycling program: 1X LCGreen Plus (Idaho Technology) 5 ng of DNA 0.4 U KlenTaq (AB Peptides) 143 ng of TaqStart antibody (ClonTech) 50 mm Tris, ph 8.5, 500 μg/ml BSA, 3 mm MgCl 2 (Idaho Technology) 0.1 μm CTGAAAGGTTACTTCAAGGAC (forward primer) 0.5 μm GACATCGCCTCTGGG (reverse primer) 0.4 μm TGGACAGGCGAGGAATACAGGT-P(probe) Denaturation at 94 C for 10 s 50 cycles of 95 C for 1 s, 57 C for 1 s, 72 C for 2 s followed by a final denaturation (94 C, 1 s) and cooling to 40 C Wittwer Lab, Dept of Pathology University of Utah Page 2

3 Melting Protocol: Samples are heated from 58 C to 88 C at 0.3 C/s in the HR-1 instrument. Time required for melting is 2 min (Total time was 3 min) A. Sample Selection: Select the samples (files) to analyze. 1) Launch Melting Wizard if not already open. 2) Under the File menu select New HR-1 3) Select the AACC/Data/HR- 1/Factor V folder. Click on Select Cur Dir at bottom right. 4) All files will be selected press Continue Wittwer Lab, Dept of Pathology University of Utah Page 3

4 B. Analysis Original melting curves are displayed. 1) Under the Genotyping menu select Unlabeled Probe analysis Derivative melting curves are displayed: 2) Normalize the probe region by adjusting the four vertical cursors so that they bracket the probe melting transition. Normalized derivative melting curves of the probe region are displayed. 3) For automatic genotyping, select Cluster from the top menu Wittwer Lab, Dept of Pathology University of Utah Page 4

5 The melting curves are now clustered by genotype. 4) What genotype is the unknown? 2006 Wittwer Lab, Dept of Pathology University of Utah Page 5

6 Technique: Unlabeled probe genotyping - LightScanner Gene target: Factor V Leiden: Detection of a G>A SNP, important in coagulation predisposition Goal: Uncover the secret message encoded by genotype on the 96-well plate. Assay diagram: amplicon size (100 bp) Probe Forward primer p-tggacataaggagcggacaggt5 5 CTGAAAGGTTACTTCAAGGACAAAATACCTGTATTCCTCGCCTGTCCAGGGATCTGCTCTTACAGATTAGAAGTAGTCCTATTAGCCCAGAGGCGATGTC 3 GAGTTTCCAATGAAGTTCATGTTTTATGGAGATAAGGAGCGGACAGGTCCCTAGACGAGAATGTCTAATCTTCATCAGGATAATCGGGTCTCCGCTACAG Reverse primer PCR protocol: Human genomic DNA samples of different Factor V Leiden genotypes were amplified in an ABI 9700 using 10 μl reaction volumes with 12 µl oil overlay, including: Cycling program: 1X LCGreen Plus (Idaho Technology) 5 ng of DNA 0.4 U KlenTaq (AB Peptides) 143 ng of TaqStart antibody (ClonTech) 50 mm Tris, ph 8.5, 500 μg/ml BSA, 3 mm MgCl 2 (Idaho Technology) 0.1 μm CTGAAAGGTTACTTCAAGGAC (forward primer) 0.5 μm GACATCGCCTCTGGG (reverse primer) 0.4 μm TGGACAGGCGAGGAATACAGGT-P (probe) Denaturation at 94 C for 10 s 50 cycles of 95 C for 5 s, 57 C for 2 s, 72 C for 2 s followed by a final denaturation (94 C, 1 s) and cooling to 40 C. Melting Protocol: Samples were heated from 58 C to 88 C at 0.1 C/s in the LightScanner instrument. Time required for melting was 5 min (Total time was 8 min) A. Sample Selection: 1) Launch Melting Wizard if not already open. Open the file to analyze Wittwer Lab, Dept of Pathology University of Utah Page 6

7 2) Under the File menu select New LightScanner 3) Open the AACC/ Data/LightScanner/ Factor V file. 4) All samples are selected. Press OK to continue. B. Analysis Original melting curves are displayed. 1) Under the Genotyping menu select Unlabeled Probe analysis Wittwer Lab, Dept of Pathology University of Utah Page 7

8 Derivative melting curves are displayed: 2) Normalize the probe region by adjusting the four vertical cursors so that they bracket the probe melting transition. Normalized derivative melting curves of the probe region are displayed. 3) For automatic genotyping, select Cluster from the top menu. The melting curves are now clustered by genotype. 4) To show genotypes by plate position, click OK to return to the main menu, then choose Show Plate Clusters under the Display menu Wittwer Lab, Dept of Pathology University of Utah Page 8

9 Colors now indicate genotype by plate position 2006 Wittwer Lab, Dept of Pathology University of Utah Page 9

10 Technique: Gene target: Whole amplicon genotyping Amplicons are usually kept small to increase the Tm difference between different homozygotes. β globin (HbS, HbC mutations): Detection of HbS (A>T) and HbC (G>A) SNPs, important in hemoglobinopathies Goal: Identify the genotypes of three unknown samples based on melting curve comparison with reference samples of five known genotypes (AA, AS, AC, SC, SS) Assay diagram: amplicon size (45 bp) HbC mutation (G16A) HbS mutation (A17T) Forward primer 5 CCATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCC 3 GGTACCACGTGGACTGAGGACTCCTCTTCAGACGGCAATGACGGG Reverse primer PCR protocol: Human genomic DNA samples of different β globin genotypes were amplified in a Roche LightCycler using 10 μl reaction volumes, including: Cycling program: 1X LCGreen I (Idaho Technology) 5 ng of DNA 0.4 U Taq (Roche) 50 mm Tris, ph 8.5, 500 μg/ml BSA, 3 mm MgCl 2 (Idaho Technology) 0.5 μm CCATGGTGCACCTGACT (forward primer) 0.5 μm GGGCAGTAACGGCAGAC (reverse primer) Denaturation at 94 C for 10 s 35 cycles of 90 C for 0 s, 60 C for 0 s, followed by a final denaturation (94 C, 0 s) and cooling to 40 C. All transitions rates at maximum (programmed at 20 C/s). Total time required for PCR was 12 min. Melting Protocol: Heat the samples from 72 C to 88 C at 0.3 C/s in the HR-1 instrument. Time required for melting is 60 s (Total time is 90 s) 2006 Wittwer Lab, Dept of Pathology University of Utah Page 10

11 A. Sample Selection: Select the samples (files) to analyze. 1) Launch Melting Wizard if not already open. 2) Under the File menu select New HR-1 3) Select the AACC/Data/HR- 1/Beta Globin folder. Click on Select Cur Dir at bottom right. 4) All files will be selected press Continue Wittwer Lab, Dept of Pathology University of Utah Page 11

12 B. Analysis Original melting curves are displayed. 1) Under the Genotyping menu select Whole Amplicon analysis. Normalize the curves by adjusting the four vertical cursors so that they are outside the melting transitions. Normalized melting curves are displayed. 2) For automatic genotyping, select Cluster from the top menu Wittwer Lab, Dept of Pathology University of Utah Page 12

13 The melting curves are now clustered by genotype. 3) What genotypes are the unknowns? (colors are matched with the correct genotypes) Wittwer Lab, Dept of Pathology University of Utah Page 13

14 Technique: Gene target: Whole amplicon and unlabeled probe multiplex genotyping Amplicons are kept small to increase the Tm difference between different homozygotes. Unlabeled probes are used to genotype SNPs that cannot be easily genotyped by ampilcon melting. HFE Detection of hemochromatosis mutations and polymorphisms important in iron metabolism Goal: Correctly identify the genotypes of three unknown samples given melting curves of reference samples with five different genotypes (WT, C282Y heterozygous and homozygous, H63D heterozygous and homozygous, and S65C heterozygous). Assay diagram: Multiplex PCR reaction: Two Small Amplicons + One Unlabeled Probe First Amplicon (78 bp): detects H63D (C187G) and S65C (A193T) TGGGCTACGTGGATGACCAGCTGTTCGTGTTCTATGATCATGAGAGTCGCCGTGTGGAGCCCCGAACTCCATGGGTTT Forward 5'-TGGGCTACGTGGATGA Reverse 5'-AAACCCATGGAGTTCGG Probe 5'-GCTGTTCGTGTTCTATGATCATGAGG-P Note: mismatch on 3 end of probe along with phosphate blocker Second Amplicon (40 bp): detects C282Y (G845A) TGGGGAAGAGCAGAGATATACGTGCCAGGTGGAGCACCCA Forward 5'-TGGGGAAGAGCAGAGATATAC Reverse 5'-TGGGTGCTCCACCTG 2006 Wittwer Lab, Dept of Pathology University of Utah Page 14

15 PCR protocol: Human genomic DNA of different hemochromatosis genotypes were amplified in a Roche LightCycler using 10 μl reaction volumes, including: 1X LCGreen Plus(Idaho Technology) 5 ng of DNA 0.4 U KlenTaq (AB Peptides) 143 ng of TaqStart antibody (ClonTech) 50 mm Tris, ph 8.5, 500 μg/ml BSA, 3 mm MgCl 2 (Idaho Technology) First Amplicon: Second Amplicon: 0.1 μm TGGGCTACGTGGATGA (forward primer) 0.5 μm AAACCCATGGAGTTCGG (reverse primer) 0.4 μm GCTGTTCGTGTTCTATGATCATGAGG-P (probe) μm TGGGGAAGAGCAGAGATATAC (forward primer) μm TGGGTGCTCCACCTG (reverse primer) Cycling program: Denaturation at 94 C for 15 s 50 cycles of 94 C for 0 s, 60 C for 1 s, 75 C for 2 s followed by a final denaturation (94 C, 0 s) and cooling to 45 C. All transitions rates at maximum (programmed at 20 C/s except 60 C to 75 2 C /s (Total time required for PCR was 23 min.) 2006 Wittwer Lab, Dept of Pathology University of Utah Page 15

16 Melting Protocol: Samples were heated from 50 C to 85 C at 0.3 C/s in the HR-1 instrument. Time required for melting was 115 s (Total time = 150 s) A. Sample Selection: Select the samples (files) to analyze. 1) Launch Melting Wizard if not already open. 2) Under the File menu select New HR-1 3) Select the AACC/Data/HR-1/HFE folder. Click on Select Cur Dir at bottom right. 4) All files will be selected press Continue Wittwer Lab, Dept of Pathology University of Utah Page 16

17 B. Analysis Original melting curves are displayed. 1) Under the Genotyping menu select Unlabeled Probe analysis Derivative melting curves are displayed: 2) Normalize the entire region by adjusting the four vertical cursors so that all melting transitions (amplicons and probes) are bracketed. Normalized derivative melting curves are displayed: Can you identify all peaks? (Hint: click on the white X s of the standards in the black squares) Can you genotype all unknowns? (Unknown #2 and #3 are hard, but you can make a guess) 2006 Wittwer Lab, Dept of Pathology University of Utah Page 17

18 The answer: 2006 Wittwer Lab, Dept of Pathology University of Utah Page 18

19 Technique: DNA matching. Instead of sequencing or genotyping by probes, match the sequence identity of samples by high resolution melting Gene target: DRß1, exon 2. A highly polymorphic HLA region important for transplantation Clinical Scenario: Polycystic kidney disease is a fatal autosomal recessive disorder potentially curable by kidney transplantation. In the large family below, four out of eleven siblings are affected. Can you find HLA compatible donors for the affected family members (#3, #4, #9 and #10)? Assay description: A 273 bp amplicon of DRß1 exon 2 was amplified with the two intronic primers listed below. The region is very polymorphic and many base changes are expected between alleles. PCR protocol: Human genomic DNA samples from each sibling in the pedigree above were amplified in a Roche LightCycler using 10 μl reaction volumes, including: Cycling program: 1X LCGreen Plus(Idaho Technology) 50 ng of DNA 0.4 U KlenTaq (AB Peptides) 88 ng of TaqStart antibody (ClonTech) 50 mm Tris, ph 8.5, 500 μg/ml BSA, 3 mm MgCl 2 (Idaho Technology) 5 μm GTCCCCACAGCACGTTTCTTG (forward primer) 5 μm CGCCGCTGCACTGTGAAGCTCTC (reverse primer) Denaturation at 95 C for 5 s 15 cycles of 95 C for 1 s, 63 C for 0 s and 72 C for 5 s, followed by 30 cycles of 95 C for 1 s, 60 C and 72 C for 5 s, followed by a final denaturation (95 C, 0 s) and cooling to 60 C. All transitions rates at maximum (programmed at 20 C/s). Total time required for PCR was 18 min Wittwer Lab, Dept of Pathology University of Utah Page 19

20 Melting Protocol: Samples were heated from 60 C to 98 C at 0.2 C/s in the HR-1 instrument. Time required for melting was 115 s Total melting cycle took 150 s. A. Sample Selection: 1) Launch Melting Wizard if not already open. 2) Under the File menu select New HR-1 3) Select the AACC/Data/HR- 1/DRB1 folder. Click on Select Cur Dir at bottom right. 4) All files will be selected press Continue Wittwer Lab, Dept of Pathology University of Utah Page 20

21 B. Analysis Original melting curves are displayed. 1) Under the Scanning menu select DNA Matching analysis. Adjust cursors as desired (cursor not shown in figure). Normalized and overlaid curves are displayed. 2) Under the Cluster menu, select Difference plot. Clustered difference plots are displayed. Who is compatible with siblings #3, #4, #9 and #10? Is there an available donor for all siblings? 2006 Wittwer Lab, Dept of Pathology University of Utah Page 21

22 Technique: Gene target: Mutation scanning demo Two amplicons (173 and 302 bp) are amplified on a 96-well plate. For each amplicon, a wild type and heterozygous mutant are present. Hepatic lipase gene: Accession # L The PCR fragments are from the 5 untranslated regulatory region. Goal: Test the reproducibility of heterozygote detection in a 96-well format. Assay diagram: PCR protocol: Human genomic DNA was amplified in a BioRad icycler using 10 μl reaction volumes, including: 1X LightScanner Master Mix (Idaho Technology) 15 ng of DNA 173 bp fragment : 0.2 μm GGGGGAAGAAGTGTGTTTAC (forward) 0.2 μm CCCAGAGGGTCCAAATTTC (reverse) 302 bp fragment : 0.2 μm GAGTGGCCTTACTTTTCAGTCC (forward) 0.2 μm TGGCTCAGGAAAGTGGTGTT (reverse) 20 µl Mineral oil each well spin, 5 min Cycling program: Denaturation at 95 C for 120 s 2006 Wittwer Lab, Dept of Pathology University of Utah Page 22

23 Melting Protocol: 40 cycles of 95 C for 30 s, 62 C for 30 s, followed by a final denaturation (94 C, 30 s) and cooling to 25 C for 30 s. All transitions rates at maximum for the BioRad icycler. Total time required for PCR was ~90 min. Samples are heated from 75 C to 94 C at 0.1 C/s in the LightScanner instrument. Hold temp is 65 C. Exposure time is set to auto. Total time required for melting is under 5 min. A. Sample Selection: 1) Launch Melting Wizard if not already open. 2) Under the File menu select New LightScanner 3) Select the AACC/Data/ LightScanner folder. Highlight the Hepatic Lipase Demo file and click Open. 4) Select either the 173 bp product on the left half of the plate, or the 302 bp product on the right half of the plate by selecting the column buttons across the top of the plate diagram. Press OK Wittwer Lab, Dept of Pathology University of Utah Page 23

24 B. Analysis Original melting curves are displayed. 1) Under the Scanning menu select Mutation Scanning analysis. Adjust cursors as desired (cursors not shown). Normalized and overlaid curves are displayed. 2) Under the Cluster menu, select Difference plot. Clustered difference plots are displayed. Reload the file and repeat for the right half of the plate to analyze the 302 bp product Wittwer Lab, Dept of Pathology University of Utah Page 24

25 Technique: Mutation Scanning A 302 bp amplicon is amplified from 96 random DNA samples to detect variation within the region. Gene target: Hepatic Lipase gene: Accession #: L The PCR fragment from the 5 untranslated regulatory region. Goal: Determine how many genotypes are present. Assay diagram (primers shown by multiple arrowheads): PCR protocol: Human genomic DNA was amplified in a BioRad icycler using 10 μl reaction volumes, including: Cycling program: Melting Protocol: 1X LightScanner Master Mix (Idaho Technology) 15 ng of DNA 0.2 μm GAGTGGCCTTACTTTTCAGTCC (forward primer) 0.2 μm TGGCTCAGGAAAGTGGTGTT (reverse primer) 20 µl Mineral oil each well spin, 5 min Denaturation at 95 C for 120 s 40 cycles of 95 C for 30 s, 62 C for 30 s, followed by a final denaturation (94 C, 30 s) and cooling to 25 C for 30 s. All transitions rates at maximum for the BioRad icycler. Total time required for PCR was ~90 min. Samples were heated from 75 C to 94 C at 0.1 C/s in the LightScanner instrument. Hold temp was 65 C. Exposure time was set to auto. Total time required for melting was about 5 min Wittwer Lab, Dept of Pathology University of Utah Page 25

26 A. Sample Selection: 1) Launch Melting Wizard if not already open. 2) Under the File menu select New LightScanner 3) Select the AACC/Data/ LightScanner folder. Highlight the Hepatic Lipase Scan file and click Open. 4) Three wells did not amplify and only show low Tm products. Raise the horizontal cursor to eliminate these samples and press OK. B. Analysis Original melting curves are displayed. 1) Under the Scanning menu select Mutation Scanning analysis. Adjust cursors as desired Wittwer Lab, Dept of Pathology University of Utah Page 26

27 Normalized and overlaid curves are displayed. 2) Under the Cluster menu, select Difference plot. Clustered difference plots are displayed. How many different genotypes are present? 3) Select, Show Plate Clusters under Display to identify the genotypes across the plate. Colors now indicate genotype by plate position Wittwer Lab, Dept of Pathology University of Utah Page 27

28 Technique: Gene target: Allele Fraction Sensitivity. In oncology studies, tumor DNA may represent only a fraction of the total DNA present in a tissue sample. To detect mutations in tumor samples, the ability to detect low allele fractions becomes important. Conventional sequencing is limited to about 20%. Genomic C G SNP Goal: Given melting curves of four different allele fractions (0, 2.5, 5, and 10%), estimate the allele fractions of the four unknown samples. PCR protocol: Different DNA samples with a G or C at one position were mixed together in different allele fractions ranging from 2.5% to 10%. A 242 bp product was amplified in a Roche LightCycler using 10 μl reaction volumes, including: Cycling program: 1X LCGreen Plus (Idaho Technology) 50 ng of DNA 0.4 U KlenTaq (AB Peptides) 88 ng of TaqStart antibody (ClonTech) 50 mm Tris, ph 8.3, 500 μg/ml BSA, 2 mm MgCl μm forward primer: CACATGGTTAAGGCCTGTTG 0.5 μm reverse primer: GATCCCACCCTTTCAGACTC Denaturation at 95 C for 5 s 40 cycles of 95 C for 0 s, 62 C for 0 s, 72 C for 5 s, followed by a final denaturation (95 C, 0 s) and cooling to 50 C. All transitions rates at maximum (programmed at 20 C/s, except between annealing and extension, where the slope was set for 2 C/s). Temperature cycling was complete in 19 min. Melting Protocol: Samples were heated from 68 C to 98 C at 0.3 C/s in the HR-1 instrument. Acquisition between 75 C and 98 C required 80 s Wittwer Lab, Dept of Pathology University of Utah Page 28

29 A. Sample Selection: 1) Launch Melting Wizard if not already open. 2) Under the File menu select New HR-1 3) Select the AACC/Data/ HR-1/Allele fractions folder. Click on Select Cur Dir at bottom right. 4) All files will be selected press Continue. B. Analysis Original melting curves are displayed. 1) Under the Scanning menu select Mutation Scanning analysis. Adjust cursors (not shown) Wittwer Lab, Dept of Pathology University of Utah Page 29

30 Normalized and overlaid curves are displayed. 2) Click OK to return to the main screen. Magnify the portion of the curves around 86 C by dragging a rectangle over the area. A magnified portion of the curve is displayed. 3) You can magnify again by dragging a new rectangle. Further magnification is displayed. Can you estimate the allele fractions of the unknowns? You can return to a regular display by clicking one of the Sample boxes Wittwer Lab, Dept of Pathology University of Utah Page 30