cdna Cloning and Sequence Analysis of Rice Sbe1 and Sbe3 Genes

Transcription

1 Rice Science, 2004, 11(3): cdna Cloning and Sequence Analysis of Rice Sbe1 and Sbe3 Genes CHEN Xiu-hua 1, LIU Qiao-quan 1,2, WU Hsin-kan 1, WANG Zong-yang 3, GU Ming-hong 1 ( 1 Agricultural College, Yangzhou University, Yangzhou , China; 2 College of Bioscience and Biotechnology, Yangzhou University, Yangzhou , China; 3 Shanghai Institute of Plant Physiology and Ecology, Chinese Academy of Sciences, Shanghai , China) Abstract: Two starch-branching enzyme (SBE) in rice, is known to be a key enzyme in amylopectin biosynthesis. The cdna of two SBE(starch-branching enzyme) genes Sbe1 and Sbe3 encoding SBE I and SBE III (two major isoforms in rice) were cloned by an improved RT-PCR technique, from a template cdna library derived from the total mrnas extracted from the immature seeds of a japonica rice Wuyunjing 7. DNA sequence analysis showed that the size of the cloned Sbe1 and Sbe3 cdnas were 2490 and 2481 bp long, respectively, including their entire coding sequences. Comparison analysis indicated that the nucleotide sequence of Sbe3 was the same as that of sbe3 (Genbank Accession No. D16201) as reported previously. There were only four base-pairs difference, which resulted in changes of two deduced amino acids between the cloned Sbe1 cdna and the reported sbe1 (Genbank Accession No. D11082). The cloned Sbe1 and Sbe3 cdnas make it possible to improve rice starch quality through genetic engineering Key words: rice; starch-branching enzyme genes; cdna sequence; gene clone There are two fractions of starch found in the rice endosperm according to their structures, namely amylose and amylopectin. The synthesis of amylose is catalyzed by the granule-bound starch synthase, which is encoded by waxy gene, while the synthesis of amylopectin is carried out by the starch branching enzyme (SBE) [1, 2]. Two main forms of SBE have been found in the rice endosperm, which are responsible for 70% and 30% synthesis of amylopectin encoded by Sbe1 and Sbe3 genes, respectively [3]. Therefore, the SBE plays a key role in the biosynthesis of starch. The ratio of amylose and amylopectin is one of the key determinants of rice starch properties, and usually results in the different end-use of rice grain. So, it becomes important to study the genetic control of amylopectin biosynthesis. Recently, the SBEs have been purified from different plants, and identified to activate the synthesis of amylopectin by introducing the β-l,6-glycosylic linkage to α -l,4-glucan. Two isoforms of starch branching enzyme SBE(A) and SBE(B) have been found in most higher plants [4]. SBE(A) isoform includes maize SBE I, rice SBE I and soybean SBE II, while SBE(B) isoform includes maize SBE II a, maize SBE II b, rice SBE III and soybean SBE I. These two isoforms differ in their catalytic and biochemical properties, and several genes or cdnas encoding the SBE isoform have been cloned [3,6]. Cloning of the rice genes involved in starch Received: 9 January 2003; Accepted: 9 May 2003 biosynthesis is the basis of understanding the mechanism of starch biosynthesis and starch quality improvement by the application of genetic engineering approach. In this study, a cdna library was constructed from the rice endosperm total mrnas based on a SMART PCR cdna Synthesis Kit, and the cdnas of rice Sbe1 and Sbe3 were then further cloned. MATERIALS AND METHODS Plant materials and preparations Rice variety Wuyunjing 7 (Oryza sativa L. subsp. japonica) was used for preparing samples of total RNA. Cloning vector pgem-t was obtained from Promega Company, SMART PCR cdna Synthesis Kit, Advantage 2 PCR Enzyme System and Nucleo Trap Gel Extraction Kit from Clontech Company, restriction endonucleases and T 4 DNA ligase from Roche Company. PCR primers were synthesized by Shanghai Sangon Limited Company. Extraction of total RNA Immature seeds at days after flowering (DAF) were collected and used to extract total RNA following the cold phenol method [5]. Synthesis of rice endosperm cdna library template A cdna library template of the rice immature seeds was synthesized according to the RT-PCR protocol

2 82 Rice Science, Vol. 11, No. 3, 2004 recommended by the SMART PCR cdna Synthesis Kit. For the synthesis of the first strand of the cdna, 1 µl total RNA, 1 µl cdna primer (CDS), 1 µl SMART II Oligo and 2 µl ddh 2 O were mixed and denatured at 70 for 2 min. After that, 5 µl of 5 first strand buffer (1 µl DTT, 1 µl 50 dntp, 1 µl MMLV RNase H RTase) were added and mixed thoroughly, and incubated at 42 for l h. After diluting with appropriate amount of TE buffer (10 mmol/l Tris-Cl, ph 7.6, 1 mmol/l EDTA, ph 8.0), the preparation was placed at 72 for 7 min. The mixture, containing the first strand of the cdna, was stored at 20 for further use. For synthesis of the second strand of the cdna, 1 µl first strand of the cdna was diluted with 9 µl ddh 2 O and added to the second strand buffer (74 µl ddh 2 O, 10 µl 10 advantage 2 PCR buffer, 2 µl 50 dntp mix, 2 µl 5 PCR Primer, 2 µl 50 advantage 2 polymerase mix) for PCR amplification. The following thermal conditions were adopted. The mixture was pre-denatured at 95 for l min, then denatured at 95 for 5 s, annealed at 65 for 5 s, and extended at 68 for 6 min, run in a total of 21 cycles. The synthesized rice endosperm cdna library template was stored at 20, and used as the template for amplification of the SBE cdnas in later experiment. PCR amplification of the SBE cdna Four primers, used for PCR amplification of the SBE cdnas, were designed and synthesized according to the published nucletide sequences of sbe1 [6] and sbe3 [3], which were B 1 P 5 (5 CCAAGCTTCAATGCTGTGTCTC ACCTCCTC3 ) and B 1 P 3 (5 TATGCGGCCGCTCCT GATCAAGAAATCTGATG3 ) for Sbe1, and B 3 P 5 (5 CCTCTAGATGGCGGCGCCGGCGTCT3 ) and B 3 P 3 (5 AGTCTAGACTCATTCCGCTGGAGCATA3 ) for Sbe3. The 5 ends of each primer was added a restriction endonuclease cutting site (Underlined bases), Hind III, Not I, Xba I and Xba I for B I P 5, B 1 P 3, B 3 P 5 and B 3 P 3, respectively. PCR were performed according to the protocol described in the kit as follows: the reaction mixture was first pre-denatured at 95 for 1 min; then in each cycle denaturation was at 95 for 30 s, annealing at 56 for 50 s and extension at 68 for 3 min, involving a total of 30 cycles followed by 68 for 10 min (post extension). Cloning of the PCR products PCR products were electrophorised on 0.7 % agarose gel, then the bands of interest were extracted from the gel using Nucleo Trap Gel Extraction Kit, and the purified products were cloned into pgem-t vector directly by T/A cloning. The ligated products were transformed into the competent cells of E. coli strain DH5α using the method described by Sambrook et al [7]. Clones were screened on selective medium through blue/white bacterial clonies. Several white clonies were selected and separately innoculated into liquid LB medium. Plasmid DNAs were extracted by alkali splitting method and used for restriction endonuclease digestion analysis. DNA sequence analysis The cloned Sbe gene cdnas encoding SBE on pgem-t vector were sequenced from both directions by Shanghai Sangon Limited Company. The DNA sequences and the deduced amino acid sequence were analyzed using Vector NTII Suite 6 and compared to those available in the database of GenBank. RESULTS Synthesis of rice endosperm cdna library template by RT-PCR The rice endosperm cdna library template was synthesized directly from the total RNA of rice immature seeds using RT-PCR according to the protocol of SMART PCR cdna Synthesis kit. The PCR products were separated on agarose gel electrophoresis. They appeared as smear (Fig. 1-A), the molecular weight of the cdnas was ranged from 0.8 kb to 4.0 kb, but mostly were between 2 3 kb. It indicated that a relatively complete cdna library could be synthesized using this improved RT-PCR technique. It was quite favorable to get genes having longer coding regions such as that of the Sbe genes. Amplification of SBE cdnas by PCR By using the synthesized rice endosperm cdna library as the template, the cdna of Sbe1 and Sbe3 were amplified by PCR using enzymes involved in the Advantaged 2 PCR Enzyme System. The results showed that a specific band of about 2.5 kb was amplified in either PCR reaction, and the size of the amplified cdnas was within our expectation (Fig. 1-B). Identification of SBE cdna clones The PCR products of the two SBE cdna were purified and ligated with the pgem-t vector, the plasmid DNA extracted from the positive clones was used for restriction endonuclease analysis. After the plasmid DNA cloned with Sbe1 cdna was digested both with Hind III and Not I (Fig. 1-C), a 2.96 kb fragment of DNA and another of about 2.5 kb were obtained. Two bands at 2.96 kb and 2.5 kb, respectively, were also seen when the plasmid DNA with Sbe3 cdna was digested with Xba I (Fig. 1-C). It exhibited again that the size of the cdna obtained was as expected.

3 CHEN Xiu-hua, et al. cdna Cloning and Sequence Analysis of Rice Sbe1 and Sbe3 Genes 83 bp M cdna bp M Sbe 1 Sbe3 Sbe1 Sbe3 M bp Fig. 1. DNA fragments of a cdna library synthesized from the rice endosperm total RNA (A), the amplified cdnas of rice Sbe1 and Sbe3 genes (B), and analysis of the positive clones of Sbe1 and Sbe3 by restriction endonuclease (C). M indicated the 100 bp DNA ladder. Sequence analysis of the identified clones with SBE cdna The clones identified by restriction enzyme digestion were then sequenced. Fig. 2 highlights the nucleotide sequence of Sbe1 cdna and its deduced amino acid sequence. The results evidenced that the total length of Sbe1 cdna was 2490 bp (not including the restriction sites at both ends), same as that we expected. Compared with the nucleotide sequence of sbe1 in GenBank (Accession No. D11082) [6], the cloned Sbe1 shared a high homology (99.84%), only four bases were different, which were located at 1298, 1907, 2156 and 2368 nucleotide sites, respectively (Fig. 2). Two of the changed bases did not cause any change while the other two resulted in two amino acids. Sequencing of Sbe3 cdna showed that it was 2481 bp (not including the restriction sites at both ends) in length. In comparison with the reported nucleotide sequence (Genbank Accession No. D16201) [3], the present cloned Sbe3 was the same (100% identity) as that of the published. In comparing the cdna sequence of sbe1 to that of sbe3, it was found that they shared a noticeable degree of identity, especially at the central portion of the sequence. In addition, sbe3 possessed an approximately 210 bp extra sequence at its 5 terminus. DISCUSSION Gene isolation and cloning are considered to be the basic issues in molecular biology and genetic engineering. Several techniques have been developed and reported for gene cloning, for example construction of a cdna library and then screening and identification of the interested genes. But this activity was costly, laborious and time consuming [8]. For cloning of cdna with known sequences, RT-PCR is an usual technique, in which polya + RNA is as template and oligo dt as primer. The first strand of the cdna is synthesized by reverse transcription, then the target cdna fragment is amplified using specific primers and Taq DNA polymerase, but the synthesized cdna by this method is often relatively short. In present study, we synthesized a relatively complete cdna library from the rice endosperm total RNA using a SMART PCR cdna Synthesis method, and most of the synthesized cdnas were in the range of 2 3 kb. The synthesis operation was quite simple and can be accomplished in one day. The two cdnas of the rice SBE we obtained, were both as long as 2.5 kb, much longer than those obtained by oligo dt primer. It might be due to the SMART II oligo and CDS primer, which have contributed their effort during cdna synthesis. Comparing with the sbe cdna sequence reported previously [3,6], the cloned cdnas of Sbe1 and Sbe3 from the japonica rice Wuyunjing 7 shared high homology, suggesting that rice SBE genes would be highly conserved in different rice genotypes. We had compared all available cloned rice Sbe genes or cdnas up to date, explored a fact that the identity of the coding sequence as well as that of the deduced amino acid sequence among them, does exist. Thus it can be concluded that the conservation of the Sbe is truly high. SBE is the key enzyme to catalyze the synthesis of amylopectin, the expression level of which would affect the quality as well as the quantity of rice starch. It was also observed that even the ratio of amylose to amylopectin was similar among rice varieties, that were usually variable in cooking and eating quality, which revealed that besides the structure difference between the coding sequences of the two starch branching enzyme cdnas, there might be other regulatory mechanisms, for example the 5

4 84 Rice Science, Vol. 11, No. 3, 2004 Fig. 2. Comparison of nucleotide and amino acid sequences between the cloned Sbe1 and the sbe1(d11082) in GenBank. The lined boxes and dashed boxes showed the changed bases and amino acids, respectively. upstream from the coding sequence, regulating the expression of the Sbe genes and finally affecting the starch quality. Cai et al. found that the 516 to +64 bp fragment of sbe1 promoter can drive the high-level expression of the gus reporter gene, while the other three fragments ( 1096 to +74 bp, 295 to +74 bp and 146 to +64 bp) can only drive a low-level expression of the gus gene [9].

5 CHEN Xiu-hua, et al. cdna Cloning and Sequence Analysis of Rice Sbe1 and Sbe3 Genes 85 The two cdnas isolated in this study would provide us a possibility to improve starch quality through genetic engineering. At the moment, we have constructed both the sense and antisense expression vectors using whole or part of the two clones combined with different known promoters, hoping to alter the expression level of the Sbe genes and finally the rice starch quality. ACKNOWLEDGEMENTS This work was supported by National High Technique Research Developing Project of China (2001AA212101), High Technique Research Project of Jiangsu Province(BG ), and Natural Science Foundation of Jiangsu Province (DK ). REFERENCES 1 Okagaki R J, Wessler S R. Comparison of non-mutant and mutant waxy genes in rice and maize. Genetics, 1988, 120(4): Martin C, SmithA M. Starch biosynthesis. Plant Cell, 1995, 7: Mizuno K, Kawasaki T, Shimada H, Satoh H, Kobayashi E, Okumura S, Arai Y, Babe T. Alteration of the structural properties of starch components by the lack of an isoform of starch branching enzyme in rice seeds. J Biol Chem, 1993, 268 (25): Burton R A, Bewley J D, Smith A M, Bhattacharyya M K, Tatge H, Ring S, Bull V, Hamilton W D O, Martin C. Starch branching enzymes belonging to distinct enzyme families are differentially expressed during pea embryo development. Plant J, 1995, 7: Zheng F Q, Wang Z Y, Gao J P. Isolation of total RNA from rice endosperm. Plant Physiol Comm, 1993, 29(6): (in Chinese) 6 Mizuno K, Kimura K, Arai Y, Kawasaki T, Shimada H, Baba T. Starch branching enzymes from immature rice seeds. J Biochem, 1992, 112 (5): Sambrook J, Fritsch E F, Maniatis T. Molecular Cloning: A laboratory manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, Xu J W, Zhu Z, Li X G. Isolation and identification of starch synthase cdna using a simple procedure based on PCR. High Tech Comm, 2001, 8: 1 6. (in Chinese with English Abstract) 9 Cai Y, Xie D L, Wang Z Y, Hong M M. Effects of upstream region deletion on rice sbe 1 gene expression. J Plant Physiol & Mol Biol, 2002, 28(1): (in Chinese with English Abstract)