DNA typing of human cell lines: historical perspective Yvonne Reid, PhD Collection/Research Scientist ATCC Cell Biology

Transcription

1 DNA typing of human cell lines: historical perspective Yvonne Reid, PhD Collection/Research Scientist ATCC Cell Biology

2 Outline Molecular techniques for the authentication of human cell lines Mechanism of gene duplication DNA fingerprinting multilocus probes DNA profiling single locus probes DNA profiling STR analysis

3 Identification of human cell lines: molecular techniques Interspecies Identification Cytochrome Oxidase subunit I (COI) Cytogenetics (G-banding) Intraspecies Identification RFLP (restriction fragment length polymorphism) Multi-locus probes (DNA fingerprinting) Single locus probes (VNTR) AMP-FLP (Amplified fragment length polymorphism) STR analysis SNP (single nucleotide polymorphism)

4 Tandem repetitive DNA sequences DNA Location Degree of Repetition Number of Loci Repeat Unit Length Satellite DNA (centromere) 10 3 to to 2 2 to several thousand bp Minisatellite (multilocus and single locus probes) (telomere) 2 to several hundred Many thousands 9 to100 bp Microsatellite (STRs) (randomly scattered) 5 to about a hundred 10 4 to to 6 bp

5 Mechanism of gene duplication Repetitive sequences or hypervariable regions are hotspot for recombination Recombination Unequal exchange of sister chromatids Unequal exchange of non-sister chromatids Retrotransposition Transposition of DNA sequence via an RNA intermediate

6 Unequal recombination of nonallelic sites (sister chromatids) Centromere Repeating unit * *

7 Unequal recombination of nonallelic sites (non-sister chromatids) Centromere Repeating unit * *

8 Retrotransposition (Transposition of a DNA sequence via RNA intermediate) Chromosome A Chromosome B Transposable Element DNA 5 5 Transcription and Processing 3 3 mrna 5 A A A A 3 cdna Reverse Transcriptase A A A T T T A 3 T 3 Reintegration Chromosome A Chromosome B

9 Multilocus probe: 33.6 Myoglobin gene Hinf1 D D A A Hinf1 GACCGAGGTCTAAAGCTGGAGGTGGGCAGGAAG GCTCCAGATTTCGACCTCCACCCGTCCTTCCTG 169 bp Hinf1 fragment Jeffreys, A. et al. Nature 314:87-73, 1985

10 Southern Blot analysis Detection p32-labeled single locus or multilocus probe Isolated DNA Restriction digestion Fig. courtesy of 2000 by Griffiths et al.

11 DNA fingerprint of 18 cell lines Probe: 33.6 (p32-labeled) Restriction enzyme: HaeIII 8.0 kb 6.0 kb 4.0 kb 3.0 kb 2.0 kb 1.0 kb Gilbert,D., Reid, YA., et al. Am J Hum Genet 45:499, 1990.

12 Properties of single locus probes (VNTR) for DNA profiling Probe Locus Size Number of alleles % heterozygosity pynh24 D2S kb 40 >97 pcmm86 D17S kb 20 >93 pcmm101 D14S13 2.2kb 30 >95 Nakamura, Y., et al. Science 235: (1987) Bever, R., et al. The Second International Symposium on Human Identification, p103 (1991) Nakamura, Y., et al. Nucleic acid Res. 15:10073 (1987) Nakamura, Y., et al. Nucleic acid Res. 16:5222 (1988) Nakamura, Y., et al. Nucleic acid Res. 16:381(1988) Nakamura, Y., et al. Nucleic acid Res. 16:5223(1988)

13 DNA profiling of 6 unrelated cell lines marker control CCL-221 HTB-22 CCL-18 HTB-19 CCL-119 CRL kb Single locus probe: D14S13 Restriction Enzyme Hinf1 3.2 kb 1.6 kb

14 Properties of the STRs for DNA profiling Locus Name Chromosomal Location Repeat motif No of repeating units Number of alleles observed D16S539 16q24-gtr GATA D7S820 7q GATA D13S317 13q22-q31 TATC D5S818 5p21-q31 AGAT CSF1PO 5q TAGA TPOX 2p23-pter GAAT VWA 12p12-pter [TCTA] [TCTG] THO1 11p15.5 TCAT Amelogenin Not STR, gender determination Power of discrimination: 1:1.2 X 10 8 Butler, JM. Forensic DNA typing, 2001

15 STR analysis EXTRACT DNA PCR AMPLIFY SAMPLE SPOT FTA PAPER RESOLVE PCR FRAGMENTS SIZE PCR FRAGMENTS CONVERT PCR FRAGMENT SIZES TO ALLELES DATABASE Curate Global Comparisons Lot to Lot Comparisons)

16 Use of allelic ladders Conversion of fragment size into alleles

17 STR Polymorphism (homozygous) AATG M P M 8 repeating units P 8 repeating units

18 STR Polymorphism (heterozygous) M P M AATG 10 repeating units P 9 repeating units

19 STR analysis for human identification 2 unrelated cell lines K562 WS1 D5S818 D13S317 D7S820 D16S539 vwa THO1 Amel. TPOX CSF1PO K562 (CML) 11, , 11 11, WS1 (Skin fibro) , 10 10, 11 17, 18 8, 10 X female X female 8, 9 9, 10 8, 9 10, 13

20 STR analysis for human identification Two related human cell lines HAAE-2 HFAE-2 D5S818 D13S317 D7S820 D16S539 vwa THO1 Amel. TPOX CSF1PO HAAE-2 aortic artery endothelium 12,13 11,12 8,10 12,13 14,18 7,9 X,Y male 10,11 10,11 HFAE-2 femoral artery endothelium 12,13 11,12 8,10 12,13 14,18 7,9 X,Y male 10,11 10,11

21 STR analysis: parental vs. clone BG01 BGO1V D5S818 D13S317 D7S820 D16S539 vwa TH01 TPOX CSF1PO Amelogenin BG01 10, 12 11, 12 10, 11 9, 11 16, 17 7, X, Y BG01V 10, 12 11, 12 10, 11 9, 11 16, 17 7, X, Y WiCell ATCC

22 Case of Gender Misidentification Human cell line purported to be of female origin Y paint STR analysis G-banding

23 Cellular cross-contamination

24 STR detects 10% contaminants (A) (B) (C) (A) Uncontaminated CCRF-SB (100%) (B) CCRF-SB/CCRF-CEM (90%/10%) (C) Uncontaminated CCRF-CEM (100%)

25 Characteristics of STR markers High discriminating power High observed heterozygosity >70% Robust and reproducible results Low stutter characteristics Low mutation rate Alleles fall in the range of bps smaller fragments better to allow for degraded DNA. Butler, JM. Forensic DNA typing, 2001

26 Frequency of genetic changes in cell lines SGM markers D18S1179 D21S11 D8S1179 FGA THO1 vwf Heterozygosity of 221 cell lines Heterozygosity in Caucasian adults 59.9% 69.8% 70.3% 69.9% % 82.7% 82.7% 87.8% Occurrence of 3 alleles 2/177 6/192 4/192 3/183 0/193 5/192 Occurrence of 4 alleles /192 Masters, JR et al. PNAS 98(14): , 2001

27 Short tandem repeat (STR) Target sequence consists of microsatellite DNA Typically use ng DNA (partial degraded) 1 to 2 fragments Highly informative; 1:10-8 (DNA profiling) Banding pattern reproducible PCR amplifiable; high-throughput; database No binning to determine fragment size allelelic ladders Cross-contaminating human cell lines are very easy to detect and interpret Probes are human-specific High stringency conditions