MRC-Holland MLPA. Description version 14;

Transcription

1 SALSA MS-MLPA KIT ME011-B1 Mismatch Repair genes (MMR) Lot As compared to version A1, two probes have been replaced and three extra probes have been added. One MSH3 probe is replaced and one removed. The number of reference probes has been increased to 15 and two control fragments at 100 and 105 nt (X, Y chromosome) have been added. The Mismatch Repair (MMR) system is critical for the maintenance of genomic stability. MMR increases the fidelity of DNA replication by identifying and excising single-base mismatches and insertion-deletion loops that may arise during DNA replication. Cells with MMR deficiency may lead to the accumulation of mutations resulting in the initiation of cancer. The MMR genes are involved in one of the most prevalent cancer syndromes in humans known as hereditary nonpolyposis colon cancer (HNPCC). There are several proteins required for the complete MMR system. Mutations in the and MSH2 have been found in about 90% of HNPCC cases. Mutations in other MMR genes have been less frequent in HNPCC patients. In many sporadic colon cancers, hypermethylation of the gene promoter resulting in its transcriptional silencing has been observed more than mutations. This ME011-A1 MMR probemix has been developed to detect aberrant CpG islands methylation of seven MMR genes and includes 6 probes for, 4 probes for MSH2, 3 probes for MSH6, 2 probes for MSH3, 1 probe for MLH3, 3 probes for PMS2 and 6 probes specific for the promoter region. plays a role in removing O(6)-alkylguanine which is the major mutagenic and carcinogenic lesion induced by alkylating mutagens. The gene is located at chromosome 3p22.1, MLH3 at chromosome 14q24.3, MSH2 at 2p21, MSH3 at 05q14.1, MSH6 gene at 2p16, PMS2 at 7p22 and the gene is located at chromosome 10q26. This kit includes 22 probes containing a HhaI recognition site, which yields information about the methylation status of a target sequences. In addition, 16 reference probes are present which are not influenced by the HhaI digestion. Besides the detection of aberrant methylation, all probes present will give information on copy number changes in the analysed sample. More information about MS-MLPA can be found on page 2. This SALSA MS- kit can be used to detect aberrant methylation of one or more sequences of the MMR genes in a DNA sample. Methylation levels can be different for different tissues. Please use DNA derived from the same type of tissue and purified by the same method as reference sample. This SALSA MS- kit can also be used to detect deletions and duplications of one or more sequences of the MMR genes. Heterozygous deletions of probe recognition sequences should give a 35-50% reduced relative peak area of the amplification product of that probe. Note that a mutation or polymorphism in the sequence detected by a probe can also cause a reduction in relative peak area, even when not located exactly on the ligation site! In addition, some probe signals are more sensitive to sample purity and small changes in experimental conditions. Therefore, deletions and duplications detected by MLPA should always be confirmed by other methods. Not all deletions and duplications detected by MLPA will be pathogenic; users should always verify the latest scientific literature when interpreting their findings. Finally, note that most defects in this gene are expected to be small (point) mutations which will not be detected by this SALSA MLPA test. We have no information on what percentage of defects in these genes is caused by deletions/duplications of complete exons. SALSA MS- kits are sold by for research purposes and to demonstrate the possibilities of the MLPA technique. This kit is not CE/FDA certified for use in diagnostic procedures. SALSA MLPA kits are supplied with all necessary buffers and enzymes. Purchase of the SALSA MLPA test kits includes a limited license to use these products for research purposes. The use of this SALSA kit requires a thermocycler with heated lid and sequence type electrophoresis equipment. Different fluorescent PCR primers are available. The MLPA technique has been first described in Nucleic Acid Research 30, e57 (2002). The MS-MLPA method for the detection of both copy numbers and methylation changes was described in Nucleic Acid Research 33, e128 by Nygren et al More information Website : info@mlpa.com (information & technical questions); order@mlpa.com (for orders) Mail : bv; Willem Schoutenstraat 6, 1057 DN Amsterdam, the Netherlands SALSA MS- kit ME011 MMR Page 1 of 8

2 Related SALSA MLPA kits P003 /MSH2: Hereditary nonpolyposis colon cancer (HNPCC) genes included: MSH2, P072 MSH6: HNPCC genes included: MSH6, MUTYH P248 /MSH2: HNPCC confirmation genes included: MSH2, P008 MSH6/PMS2: HNPCC genes included: MSH6, PMS2, MUTYH References of SALSA MLPA kit ME011 Jeuken JW et al. (2007). MS-MLPA: an attractive alternative laboratory assay for robust, reliable, and semiquantitative detection of promoter hypermethylation in gliomas. Lab Invest Aug 13. Perez-Carbonell, L. et al. (2010). Methylation analysis of improves the selection of patients for genetic testing in Lynch syndrome. J.of Mol.Diagn. 12, July Gylling, A. et al. (2009) large genomic rearrangements and germline epimutations in Lynch syndrome. Int.J.cancer 124: Please note During testing on various tumour samples, we have observed that many probes undergo significant methylation changes. However, as we have little access to patient samples, it is unfortunately not possible for to validate each probe on samples with known decreased mrna levels and of which the methylation status of the sequences has been confirmed by independent methods. The MS-MLPA probes are in promoter regions which are unmethylated in normal blood-derived control samples, and they do not generate a signal after HhaI digestion in normal blood derived reference samples. We have tested each probe by in vitro methylation of sample DNAs with HhaI methylase, and found each signal indeed remains intact after HhaI digestion. Methylation-specific MLPA Each MS-MLPA reaction generates two samples that need analysis by capillary electrophoresis: one undigested sample for copy number detection and one digested sample for methylation detection. A modification of the MLPA technique, MS-MLPA allows the detection of both copy number changes and unusual methylation levels of different sequences in one simple reaction. MLPA probes for methylation quantification are similar to normal MLPA probes, except that the sequence detected by the MS-MLPA probe contains the sequence recognized by the methylation-sensitive restriction enzyme HhaI. Similar to ordinary MLPA reactions, the MS-MLPA protocol starts with sample DNA denaturation and overnight hybridization. The reaction then is split into two tubes. One tube is processed as a standard MLPA reaction. This reaction provides information on copy number changes. The other tube of the MLPA hybridization reaction is incubated with the methylation-sensitive HhaI endonuclease while simultaneously, the hybridized probes are ligated. Hybrids of (unmethylated) probe oligonucleotides and unmethylated sample DNA are digested by the HhaI enzyme. Digested probes will not be exponentially amplified by PCR and hence will not generate a signal when analyzed by capillary electrophoresis. In contrast, if the sample DNA is methylated, the hemimethylated probe-sample DNA hybrids are prevented from being digested by HhaI and the ligated probes will generate a signal. More information about MS-MLPA can be found in the MS-MLPA protocol. Please note that this product can not be used with an alternative protocol in which the genomic DNA is first digested with HhaI, followed by MLPA reactions on both digested and undigested genomic DNA. Data analysis The ME011-B1 MMR probemix contains 38 different probes with amplification products between 136 and 400 nt. In addition, it contains 9 control fragments generating an amplification product smaller than 120 nt: four DNA Quantity fragments (Q-fragments) at nt, three DNA denaturation control fragments (Dfragments) at nt, one X-fragment at 100 nt and one Y-fragment at 105 nt. More information on how to interpret observations on these control fragments can be found in the MLPA protocol. The analysis of MS-MLPA kits consists of two parts: 1) determining copy numbers by comparing different undigested samples, and 2) determining methylation patterns by comparing each undigested sample to its SALSA MS- kit ME011 MMR Page 2 of 8

3 digested counterpart (MS-MLPA kits only). The second part is unique for MS-MLPA kits and serves to semiquantify the percentage of methylation within a given sample. 1) Copy number analysis - Selection of reference probes First select suitable reference probes for copy number detection. These are probes detecting relatively quiet regions in the particular type of tumour studied. The reference probes selected will therefore depend on the application. Probes that are suitable to use for reference in many types of tumour are indicated in Table 1. - Intra-sample data normalisation For analysis of MLPA results, not the absolute fluorescence values but intra-normalized data are used (relative peak areas). The data generated in the undigested sample should first be normalized intra-sample by dividing the signal of each probe by the signal of every reference probe in that sample, thus creating as many ratios per probe as there are reference probes. Subsequently, the median of all these produced ratios per probe should be taken; this is the probe s Normalisation Constant. This Normalisation Constant can then be used for sample to reference sample comparison. - Inter-sample normalisation (comparison with reference samples) The final probe ratio, or ploidy status, of each probe in each sample is calculated by dividing a) the Normalisation Constant of each probe obtained on the undigested test sample by b) the average Normalisation Constant of that probe obtained on the undigested reference samples. 2) Methylation analysis - Selection of reference probes Use the reference probes for methylation as marked in Table 1. All reference probes used for methylation analysis do not contain a HhaI site. - Intra-sample data normalisation For analysis of MLPA results, not the absolute fluorescence values but intra-normalized data are used (relative peak areas). The data generated in the digested sample should first be normalized intra-sample by dividing the signal of each probe by the signal of every reference probe in that sample, thus creating as many ratios per probe as there are reference probes. Subsequently, the median of all these produced ratios per probe should be taken; this is the probe s Normalisation Constant. This Normalisation Constant can then be used for sample to reference sample comparison. - Methylation analysis (comparison with reference samples) The methylation status of each MS-MLPA probe* in each sample is calculated by dividing a) the Normalisation Constant of each probe obtained on the digested test sample by b) the Normalisation Constant of each MS- MLPA probe obtained on the corresponding undigested sample. Multiplying this value by 100 gives an estimation of the percentage of methylation. Aberrant methylation can then be identified by comparing the methylation status of one or more MS-MLPA probes in the sample in question to that obtained on reference samples. *Note: An MS-MLPA probe targets a single specific HhaI site in a CpG island; if methylation is absent for a particular CpG-site, this does not necessarily mean that the whole CpG island is unmethylated! For samples containing both tumour and normal cells, MLPA experiments will indicate the average copy number of genes. Data used for normalisation should have been obtained within a single experiment. Only samples from the same tissue and purified by the same method should be compared. Confirmation of most exons deletions and amplifications can be done by e.g. Southern blots, long range PCR, qpcr, FISH. Note that Coffalyser, the MLPA analysis tool developed at, can be downloaded free of charge from our website This probemix was developed at. SALSA MS- kit ME011 MMR Page 3 of 8

4 Table 1. SALSA MS-MLPA ME011-B1 MMR probemix Length HhaI Chromosomal Reference probe for SALSA MLPA probe (nt) site position Copy number Methylation Q-fragments: DNA quantity; only visible with less than 100 ng sample DNA D-fragments: Low signal of 88 or 96 nt fragment indicates incomplete denaturation 100 X-fragment: Specific for the X chromosome 105 Y-fragment: Specific for the Y chromosome 130 * CTTN probe L q13.3 Yes Yes 136 * KCNJ6 probe L q22.13 Yes Yes 142 PMS2 probe L p probe L p22.2 Yes 154 PMS2 probe L p MSH6 probe L p probe L p * probe L q TNFRSF1A probe L p13.31 Yes Yes 184 MSH2 probe L p * PROKR2 probe L p12.3 Yes Yes 196 probe L p probe L q MSH6 probe L p * probe L q MSH3 probe L q PAH probe L q23 Yes Yes 238 probe L p * MSH2 probe L p21 Yes 256 * SEPT9 probe L q25.3 Yes Yes 265 probe L p MSH2 probe L p * MSH3 probe L q14.1 Yes 292 probe L p MSH6 probe L p * CACNA1A probe L p13.2 Yes Yes 319 * TSC1 probe L q34.13 Yes Yes 328 * KCNQ L p15.5 Yes Yes 339 PMS2 probe L p * probe L q MLH3 probe L q CUGBP2 probe L p14 Yes Yes 373 * ABCB4 probe L q21.12 Yes Yes 382 * FBN1 probe L q21.1 Yes Yes 391 * ± probe L q MSH2 probe L p * probe L q * TSC2 probe L p13.3 Yes Yes * New in version B1 (from lot 1009 onwards). Changed in version B1 (from lot 1009 onwards). Small change in length, no change in sequence detected. SNP rs could influence the probe signal. In case of apparent deletions, it is recommended to sequence the region targeted by this probe. ± This probe is located within, or close to, a very strong CpG island. A low signal of this probe can be due to incomplete sample DNA denaturation, e.g. due to the presence of salt in the sample DNA. Note: Please notify us of any mistakes: info@mlpa.com. SALSA MS- kit ME011 MMR Page 4 of 8

5 Table 2. ME011 probes arranged according to chromosomal location Length (nt) SALSA MLPA probe Gene / exon MSH2 startcodon is at in NM_ L07711 MSH2 NM_ nt before ATG L13115 MSH2 NM_ nt before ATG L00599 MSH2 NM_ exon nt after ATG L12398 MSH2 nt in exon 7 NM_ Chr. & kb to p-telomere (hg18) (partial) probe sequence with HhaI sites Ligation site relative to ATGstartcodon CGAAACCCGCAGACGCGCATCCT- TAGTAGAGCTCCTTTCTGTGTTTACTCA TAGCTAAAGTCACCAGCGTGCGCGGGA- AGCTGGGCCGCGTCTGCTTATGATTGG CCTTTTCGACCGGGGCGACTTCT- ATACGGCGCACGGCGAGGACGCGCTGC GCCAAGAAGTTTCAAAGACAAGCAGCA- AACTTACAAGATTGTTACCGACTCTATC MSH6 startcodon is at in NM_ One more MSH6 MS-MLPA probe is present in the ME-002 probemix L05732 MSH6 NM_ CCAGCCCCGCGGCGTGAGGGA nt before ATG AGGGGAGCTCAGCAGTTCCCCGCGCGG L05733 MSH6 NM_ CGAGGCGCCTGTTGATTGGCCACT exon nt before ATG GGGGCCCGGGTTCCTCCGGCGGAGCGC L05731 MSH6 NM_ CGTTCTGTCGGACGGAGCTCCTAAAA exon 1 32 nt before ATG GCACCGCATCTACCGCGCGGCTCCTGCT The most important methylation region for expression, the Deng C-region, is from -248 to -178 nt before the transcription site. The transcription start site that Deng used for reference lies 21 nt before the startcodon. The second most important region, the Deng D-region, is from -9 to +15 nt (Deng G. et al (1999) Cancer Research 59, and Capel, E. et al (2007) Oncogene 26: ). For this reason, methylation of the 198 nt and 166 nt probes will be most important for mrna expression. It is not possible for us to design extra MLPA probes in these regions as there are no other HhaI sites L L L L L L01745 exon 1 intron nt before (Deng, A-region) 518 nt before (Deng, B-region) NM_ nt before (rev.) (Deng, B-region) 246 nt before (Deng, C-region) 13 nt before (Deng, D-region) 206 nt after TCCGCCACATACCGCTCGTAGTAT- TCGTGCTCAGCCTCGTAGTGGCGCCTGA GGGTCCACTCGGGCCGGAAAACT- AGAGCCTCGTCGACTTCCATCTTGCTTC CTGCTGAGGTGATCTGGCGCAGA- GCGGAGGAGGTGCTTGGCGCTTCTCAG AGCGGACAGCGATCTCTAACGCGCAA- GCGCATATCCTTCTAGGTAGCGGGCAGT GAGCATCTAGACGTTTCCTTGGCTCT- TCTGGCGCCAAAATGTCGTTCGTGGCAG CGGACACGCCTCTTTGCCCGGGCAGA- GGCATGTACAGCGCATGCCCACAACGGC MSH3 startcodon is at in NM_ L14208 MSH3 NM_ nt before (rev.) L00795 MSH3 NM_ exon 1 76 nt after CTTTCTGCTGCGCGGGAGGCCCAGT- TGCTGATTTCTGCCCGGATTCTGCTGCC CGAGGCAAGCGGTTTTGAGCCGAT- TCTTCCAGTCTACGGGAAGCCTGAAATC PMS2 startcodon is at in NM_ more PMS2 probes are in the P008 probemix L16147 PMS2 NM_ GCAAAAGGGGGTAGCGCGTGCCAAAG nt before GCCAACGCTCAGAAACCGTCAGAGGTCA L16571 PMS2 NM_ GGCCAATGGGAGTTCAGGAGGCGGA exon 1 62 nt before GCGCCTGTGGGAGCCCTGGAGGGAACT L13112 PMS2 NM_ GCTCGAGGTGAGCGGGGCTCGCAGTCT intron 1 40 nt after TCCGGTGTCCCCTCTCGCGCGCCCTCTT SALSA MS- kit ME011 MMR Page 5 of 8

6 Length (nt) SALSA MLPA probe Gene / exon Reference probes on chromosomes 7, 9, L04144 ABCB4 exon L03897 TSC1 exon L00781 CUGBP2 exon 1(rev) Chr. & kb to p-telomere (hg18) (partial) probe sequence with HhaI sites Ligation site relative to ATGstartcodon GCAAATGTGCCACCAGTGTCCTT- TCTGAAGGTCCTGAAACTGAATAAAACA CTCAGCTCCAGGAGCAGCGTGACACT- ATGGTAACCAAGCTCCACAGCCAGATCA CCATTTTTTCCTGACATTCACTGT- GGAAATTTGGTGCACGACACTGTTAGG The startcodon is at in. Two methylation hot spots near the transcription start site denote silencing of the gene (Qian, X.C. & Brent, T.P. (1997) Cancer research 57: Between these methylation hot spots is a region which is much less frequently methylated (Fig. 3 of Qian et al). Included in this ME011-B1 probemix are 6 methylation specific MLPA probes for the region surrounding the transcription and translation start sites. Based on the article of Qian et al, as well as preliminary data obtained with this probemix by Judith Jeuken (Nijmegen), we recommend to disregard at this moment the results obtained with the 346 nt probe (located between the methylation hot spots and showing methylation in only rare cases) and the 409 nt probe which shows frequent methylation but which also shows methylation in some samples in which the other 5 probes do not show any methylation. More information on the probes on the next page L L L L L L16573 intron 1 intron 1 intron nt before ATG startcodon = 406 nt before transcription start 346 nt before ATG 93 nt before (rev.) 151 nt after 233 nt after (rev.) 464 nt after (rev.) CGTGCAAGCGACCTGCCACGT- GCCCGAGTGGTCCTGAAAGCGCGCGGG GGTCGTAGGACGGCGCCCGCTTAGTGA TTGGCAAACTAAGGCACAGAGCCTCA- GGCGGAAGCTGGGAAGGCGCCGCCCGG CGGAGCCGAGGACCTGAGAAAAGCAA- GAGAGCGCGCGGGGGCGGGGCCGGG TTCGGGACGGTGGCAGCCTCGAGTGGT- CCTGCAGGCGCCCTCACTTCGCCGTCGG AGGCTGGGCAACACCTGGGAGGCACTT- GGGGCGCACCTGGAGCTCGCCCGGGAT CTAAGTATGCTAAAGGGTTGCTGCAA- GCCAAGGCCCGCGCAGGGGCTTCTGGA Reference probes on chromosomes 11 and L04802 KCNQ1 exon L00020 CTTN exon L13113 TNFRSF1A exon L13114 PAH exon CATCGGCTTCCTGGGCCTCATCT- TCTCCTCGTACTTTGTGTACCTGGC GGCTTCCTTCAAGGCAGAGCTGA- GCTACAGAGGCCCTGTGAGTGGGACGG GACTGCCACACTGCCCTGAGCCCAA- ATGGGGGAGTGAGAGGCCATAGCTGTC CTTTCAGTGCCCTGGTTCCCAAGAA- CCATTCAAGAGCTGGACAGATTTGCCAA The MLH3 startcodon is in exon 2. MLH L07722 exon 1 nt in NM_ CGTGGGCACGCACGAGCCTCA- AGATCCAAGGTGCGCGCGTCGGCGTCC Reference probes on chromosomes 15, 16, 17, 19, 20 and L01903 FBN1 exon L12763 TSC2 exon L09804 SEPT9 exon L15938 CACNA1A exon GGGTCATTCAAGTGTCAGTGTCCCAGT- GGAATGACTTTGGATGCCACAGGAAGG CCTGCACGAGCTTGGCTCTGGCTT- TCACCATCCTCTTCCTGACAGGCCTTTG GGAGAGGCAGGAGCTGGATCAGA- TCTGAATCCAGAGGCTCTCGGAGGAAG TGCATGGTCAAAACTCAGGCCTTCT- ACTGGACTGTACTCAGTTTGGTAGCTCT SALSA MS- kit ME011 MMR Page 6 of 8

7 Length (nt) SALSA MLPA probe Gene / exon Chr. & kb to p-telomere (hg18) (partial) probe sequence with HhaI sites Ligation site relative to ATGstartcodon L12774 PROKR2 TCGTCATTGGCATTGCACTGGCA exon 1 GGCATCATGCTGGTCTGCGGCATCGGT L04594 KCNJ6 TGACATGCCAAGCTCGAAGCTCCT exon 4 ACATCACCAGTGAGATCCTGTGGGGTTA SNP rs could influence the probe signal. In case of apparent deletions, it is recommended to sequence the region targeted by this probe. ± This probe is located within, or close to, a very strong CpG island. A low signal of this probe can be due to incomplete sample DNA denaturation, e.g. due to the presence of salt in the sample DNA. The HhaI sites are marked with grey. Ligation sites are marked with - Complete probe sequences are available on request: info@mlpa.com. probes in ME011. GGTCTCTGCTGGTCTGGGGGTCCCTGACTAGGGGAGCGGCACCAGGAGGGGAGAGACTCG CGCTCCGGGCTCAGCGTAGCCGCCCCGAGCAGGACCGGGATTCTCACTAAGCGGGCGCCG 1 TCCTACGACCCCCGCGCGCTTTCAGGACCACTCGGGCACGTGGCAGGTCGCTTGCACGCC 2 CGCGGACTATCCCTGTGACAGGAAAAGGTACGGGCCATTTGGCAAACTAAGGCACAGAGC CTCAGGCGGAAGCTGGGAAGGCGCCGCCCGGCTTGTACCGGCCGAAGGGCCATCCGGGTC 3 AGGCGCACAGGGCAGCGGCGCTGCCGGAGGACCAGGGCCGGCGTGCCGGCGTCCAGCGAG 4+5 GATGCGCAGACTGCCTCAGGCCCGGCGCCGCCGCACAGGGCATGCGCCGACCCGGTCGGG CGGGAACACCCCGCCCCTCCCGGGCTCCGCCCCAGCTCCGCCCCCGCGCGCCCCGGCCCC 9 GCCCCCGCGCGCTCTCTTGCTTTTCTCAGGTCCTCGGCTCCGCCCCGCTCTAGACCCCGC 10 CCCACGCCGCCATCCCCGTGCCCCTCGGCCCCGCCCCCGCGCCCCGGATATGCTGGGACA 11 GCCCGCGCCCCTAGAACGCTTTGCGTCCCGACGCCCGCAGGTCCTCGCGGTGCGCACCGT TTGCGACTTGGTGAGTGTCTGGGTCGCCTCGCTCCCGGAAGAGTGCGGAGCTCTCCCTCG GGACGGTGGCAGCCTCGAGTGGTCCTGCAGGCGCCCTCACTTCGCCGTCGGGTGTGGGGC 14 CGCCCTGACCCCCACCCATCCCGGGCGAGCTCCAGGTGCGCCCCAAGTGCCTCCCAGGTG 15 TTGCCCAGCCTTTCCCCGGGCCTGGGGTTCCTGGACTAGGCTGCGCTGCAGTGACTGTGG 16 ACTGGCGTGTGGCGGGGGTCGTGGCAGCCCCTGCCTTACCTCTAGGTGCCAGCCCCAGGC CCGGGCCCCGGGTTCTTCCTACCCTTCCATGCTGCCAGCTTTCCCTCCGCCAGCTGCTCC AGGAAGCTTCCAGAAGCCCCTGCGCGGGCCTTGGCTTGCAGCAACCCTTTAGCATACTTA 17 ATG = Translation start codon. CTC = mrna start () 1-17: HhaI sites Blue: SNPs according to dbsnp vs Red: Repeat region according to the Santa Cruz website. Underlined is the coding sequence of exon 1. In italic the primers are marked used by Danam, R.P. et al (2005) Mol. Cancer Ther. 4:61-69 to amplify the hotspot 1 region located from -250 to -101 with respect to the transcription start. Hot spot 2 region is located between +97 and +196 from the transcription start. probes in the new ME011-B1 kit (lot 1009): Probe L12791 (391 nt) is sensitive to methylation of Hha1 sites 1+2 (reverse). Probe L14276 (202 nt) is sensitive to methylation of Hha1 site 3. ** Probe L15582 (346 nt) is sensitive to methylation of Hha1 site 10 (reverse). Probe L14205 (214 nt) is sensitive to methylation of Hha1 site 14. Probe L15736 (172 nt) is sensitive to methylation of Hha1 site 15 (reverse). Probe L16573 (409 nt) is sensitive to methylation of Hha1 site 17 (reverse). probes in the previous ME011-A1 kit (lots 0407, 0807, 0408, 0609): * Probe L01261 (373 nt) is sensitive to methylation of Hha1 site 1. This probe had to be replaced as it resulted in a non-specific peak at 350 nt. in the No DNA control reactions. * Probe L05146 (191 nt) is sensitive to methylation of Hha1 site 3. This probe is also present (but elongated in order to make it less sensitive to a polymorphism) in the new B1 version. Probe L05144 (319 nt) is sensitive to methylation of Hha1 site 13. This probe was replaced as a frequent polymorphism within this Hha1 site, is expected to lead to false positive results of the methylation detection. SALSA MLPA kit ME011-B1 MMR sample picture SALSA MS- kit ME011 MMR Page 7 of 8

8 SALSA MLPA kit ME011-B1 Mismatch Repair Genes sample pictures Size (nt) Figure 1. Capillary electrophoresis pattern from a sample of approximately 50 ng human male control DNA analyzed with SALSA MLPA kit ME011-B1 MMR (lot 1009). This sample was not digested with Hha1 during the ligation reaction Size (nt) Figure 2. Capillary electrophoresis pattern from a sample of approximately 50 ng human male control DNA analyzed with SALSA MLPA kit ME011-B1 MMR (lot 1009). This sample was digested with Hha1 during the ligation reaction. Implemented Changes the following has been altered compared to the previous product description version(s). Version 14 (06) - Two extra references added on page 2. Version 13 (06) - Various textual changes in table 2. - Information added about the probes on page 7. Version 12 (06) - Product description adapted to a new lot (lot number added, changes in Table 1/2, new picture). - Various minor textual changes on page 1, various minor layout changes, tables have been numbered. - Data analysis section has been modified. For copy number analysis and methylation analysis different reference probes should be used (see Table 1). SALSA MS- kit ME011 MMR Page 8 of 8