Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.

Transcription

1 UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination MOLECULAR BIOLOGY BIO-2B02 Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C. Write answers to EACH SECTION in a SEPARATE booklet. The maximum number of marks available for your answers in SECTION A is 40 marks The maximum number of marks available for your answer in SECTION B is 30 marks The maximum number of marks available for your answer in SECTION C is 30 marks The TOTAL number of marks available for the paper is 100 Numbers in square brackets [ ] indicate the relevant mark applied to each part of the question. Notes are not permitted in this examination. Do not turn over until you are told to do so by the Invigilator. BIO-2B02 Module Contact: Dr Gabriella Kelemen, BIO Copyright of the University of East Anglia Version 1

2 2 SECTION A: MULTIPLE CHOICE AND SHORT ANSWER QUESTIONS Answer ALL questions in the same answer booklet. All multiple choice questions have one correct answer. 1. Which statement is NOT correct about the bacterial transcriptional activator MerR? a) MerR binds DNA between the -10 and -35 promoter sequence of its target gene b) In the absence of MerR, the -10 and -35 promoter sequences of the MerR target gene are not correctly aligned c) MerR binds to RNA polymerase d) MerR can bind mercury e) In the presence of mercury MerR twists the DNA 2. Which of the following statements related to the activity of the subunit of the RNA polymerase in the bacterium E.coli is NOT correct? a) The subunit is the specificity factor of the RNA polymerase holoenzyme b) There is a subunit that binds to DNA in the absence of the core RNA polymerase c) The principal subunit can bind to DNA only when it is part of the RNA polymerase holoenzyme and is released when elongation starts d) The subunit is part of the RNA polymerase holoenzyme and only released when transcription is terminated e) The subunit is responsible for the initiation of transcription at the correct site by the RNA polymerase holoenzyme 3. The spliceosome consists of: a) micrornas b) protein only c) proteins and RNA d) nucleosomes e) DNA 4. What are micrornas derived from? a) Perfect double stranded RNA molecules b) Injected double stranded RNA molecules c) trnas d) Precursor RNA molecules with stem-loop structures e) RNA with strong alpha helix structure Section A continues on next page/...

3 3 Section A continued Which of the following statements relating to protein phosphorylation is untrue? a) It is a post-translational modification b) It can occur on tyrosine residues c) It can occur on serine residues d) It is irreversible e) It can act as a regulatory switch 6. Anfinsen s experiment on the folding of ribonuclease A showed that protein folding is: a) a process of trial-and-error b) a thermodynamically unfavourable process c) a spontaneous process d) dependent on post-translational modification e) dependent on molecular chaperones 7. The 5' 3' exonuclease activity of E. coli DNA polymerase I is involved in: a) formation of a nick at the DNA replication origin b) formation of Okazaki fragments c) proofreading of the replication process d) removal of RNA primers by nick translation e) sealing of nicks by ligase action 8. Topoisomerases can: a) change the linking number (Lk) of a DNA molecule b) change the number of base pairs in a DNA molecule c) change the number of nucleotides in a DNA molecule d) convert D isomers of nucleotides to L isomers e) interconvert DNA and RNA Section A continues on next page/... TURN OVER

4 4 Section A continued The human syndrome Xeroderma pigmentosum is associated with defects in which of the following DNA repair mechanisms? a) Direct reversal by photolyases b) Base excision repair c) Nucleotide excision repair d) Homologous recombination e) Non-homologous end joining 10. In a GST pull-down assay, GST is: a) a fusion partner b) a bait protein c) Glucose S transferase d) a prey protein e) a ligand 11. Fill in the missing words: [6 marks] In the bacterium Escherichia coli, most transcriptional activators recruit the enzyme (a) in order to promote transcription initiation. This holoenzyme contains several subunits. One of these subunits, the (b) is responsible for promoter recognition by binding to the (c) and (d) promoter sequences. The transcriptional activator of the lac operon is called (e). This activator makes direct contact with the C-terminal domain of the (f). 12. Fill in the missing words: [5 marks] The elements in eukaryotic promoters which activate transcription are usually found in the (a) sequence. They bind transcription factors which (b) the intervening DNA to contact the basal transcriptional apparatus. The DNA is bound by histones to form (c). This structure is usually (d) to transcription and DNA:histone interaction can be loosened by the (e) of histones to allow access to transcription factors. Section A continues on next page/...

5 5 Section A continued Briefly compare and contrast the structure and function of the GroEL/ES and 26S proteasome complexes. [6 marks] 14. Match the damage type or repair step on the left with an appropriate repair enzyme on the right. Only one answer will be appropriate for each. [4 marks] (a) cytosine deamination (b) base loss (c) binds to mismatch in DNA (d) DNA synthesis in gaps (1) hypoxanthine-n-glycosylase (2) AP endonuclease (3) muth protein (4) DNA polymerase I (5) uracil N-glycosylase (6) muts-mutl complex (7) ABC exonuclease (8) DNA photolyase 15. Fill in the missing words: [3 marks] (a) blotting is a technique where fragments of genomic DNA are detected by a radioactive DNA probe. Northern blotting is a similar technique where the presence of specific (b) can be detected by a radioactively labelled nucleic acid probe. These techniques involve separation of nucleic acids on gels and transferring them to a membrane. The membrane is then (c) to labelled nucleic acid probes recognising the DNA/RNA to be studied. 16. Define the term functional genomics and explain briefly what information can be derived from its use. [6 marks] END OF SECTION A START YOUR ANSWER TO THE NEXT SECTION IN A NEW BOOKLET Section B begins on next page/... TURN OVER

6 6 SECTION B: DATA HANDLING QUESTION Answer ALL PARTS of the question 17. The following sequence describes a gene in the human genome and the different regions are indicated by different fonts: - lower-case italic letters are non-transcribed sequences - UPPER-CASE ITALIC letters are the 5 and 3 un-translated regions (UTRs) - lower-case letters are exons - UPPER-CASE letters are introns - start and stop codons are bold - underlined sequence is a predicted microrna-140 target site ccaaaacccaaatttcggcgcgcgcagtagacctatccagctttgtgccaggagtctcgcgggggttgctgggattgggactttc ccctcccacgtgctcaccctggctaaagttctgtagcttcagtgatacgcgatatatcgcatcgtagcgtgt AGTAGTGTGATCGAGCAGTATGCGCGATTATATCGGCACTATTATATCGGCGCCGACA TTTCGGCGATTAGatgccttccttcccagtcggatatcagcctcgagctccctctgagccaggagacattttcaggcttat ggaaactgtgtttgaaagggtgggccccggggagttgtctttcgtgtgacctttcaatg CCTCTTTTTCTCTGTCTAGATTTGGGGGTTCCTCTTCAGCCTGTAGACTGTGAAAACCC CCAGccctcccctcactgcatggacgatctgttgctgccccaggatgttgaggagttttttgaaggcccaagtgaagccctccg agtgtcaggagctcctgcagcacaggaccctgtcaccgagacccctgggccagtggcccctgccccagccactccatggccc ctgtcatcttttgtcccttctcaaaaaacttaccagggcaactatggcttccacctgggcttcctgcagtctgggacagccaagtctg ttttgggggcggtaaaagggccctcaacatgcgattatatcgcgcggatcgactagcgtaa GTGCCGAATCGATCATGCGCTCGATAGAGCATCGTAGCGCATGACCCGCCTGTGGGG TTAGGACTGGCAGCCTCCCATCTCCCGGCTTCTGACTTATTTTTGCTTTTAGcgccgccca cctgcacaagcgcctctcccccgcaaaagaaaaaaccacttgatggagagtatttcaccctcaaggtacgcaggcg GGACCAAGGAGGCGGAGGAGCCTGTTGAGCTTCAGcctttttgggttaaatattttagctcggctagagc atgcgatttatcggggctgtgtgatataatatgccgatgtgcagtatagatcatgcatgcgggattattagccggatcagctaggc gcattttcccaaaaacggtcaaagtcacctcttgctctctccttccacagcctccagcctagagccttcc aagccttgatcaaggaggaaatagctcccatcacttcatccctccccttttctgtcttcctatagc TACCTGAAGACCAAGAAGGGCCAGTCTACTTCCCCCATAAAAAAACAATGGTCAAGAA AGTGGGGCCTGACTCAGACTGACCTAGCTTAAGGTAAAACCACTGGAAAACCTTTAAA aagggaaggcctccctcttttttttttttttacccctttttatatatcaatttcctattttacaataaaattttgttatcacttatcgtgtgtgtgta gcgacgcccagagagcgatgcatgcg Section B Q17 continues on next page/...

7 7 Section B Q17 continued... (a) Design a pair of primers to amplify the entire coding sequence (write down 15 nucleotides for each primer) using Polymerase Chain Reaction (PCR). [5 marks] Forward (5 primer): Reverse (3 primer): (b) Design a pair of PCR primers to amplify the second exon (write down 15 nucleotides for each primer): [5 marks] Forward (5 primer): Reverse (3 primer): (c) To test whether this gene can be regulated by microrna-140 you need to clone the entire 3' UTR sequence and then introduce mutations into the predicted microrna target site (underlined in the sequence). Design a pair of primers to amplify the 3'UTR sequence (write down 15 nucleotides for each primer): [5 marks] Forward 1(5 primer): Reverse 2 (3 primer): (d) Describe how you would use PCR to replace the seed sequence (ACCACT) within the mirna target site with a BamHI restriction site (GGATCC) and hence introduce mutations into the predicted microrna-140 target site. List the sequence of the PCR primers you will need. [10 marks] Forward 1(5 primer): Reverse 2 (3 primer): (e) Once you have the wild type and mutant fragments, explain how you would test whether the gene can indeed be regulated by microrna-140. [5 marks] END OF SECTION B START YOUR ANSWER TO THE NEXT SECTION IN A NEW BOOKLET Section C begins on next page/... TURN OVER

8 8 SECTION C: ESSAY QUESTION Answer ONE question [30 marks] 18. Ligand binding alters the DNA-binding affinities of bacterial transcription factors either promoting or blocking transcription initiation. Identify the ligands and discuss the molecular interactions as well as the mechanism of action of two examples of bacterial transcription factors. 19. Explain the Wobble Hypothesis and how this allows redundancy of the genetic code. 20. DNA synthesis is involved in several different processes in all cells. Describe the different classes of enzymes that are common to all types of DNA synthesis, including brief details of their functions. Provide a fuller description of the roles of different DNA polymerases in these reactions. END OF PAPER

9 9 BIO-2B02 EXAMINATION MARKERS [Do not print this when printing to take to Examinations Office! This is for our information only.] Question No. 1 st Marker 2 nd Marker Section A Q1-16 Dr G Rowley Prof V Ellis Section B Q17 Prof T Dalmay Dr G Kelemen Section C Q18 Dr G Kelemen Prof T Dalmay Section C Q19 Prof I Clark Dr M Coleman Section C Q20 Dr G Rowley Dr Prof V Ellis