Answer sheet. Student number:

Transcription

1 Page 1 of 9 MIDTERM EXAM OF BIO/BPS Answer sheet Name: Student number: Part II: Calculations 1 128g g 3 NaCl: 1L Water: 0.2L g/l :4: ml 8 Plasmid A: 3.75 µl Plasmid B: 0.5 µl Water: µl Part III: Bioinformatics 1 E= AluI: 6 HpaII: 4 3 A+D 950bp 4 941bp bp 5 TGATTG Part IV: Theory 1 C 2 B 3 A A A D Part V: Problems 1a 8 U/µL 1b Insert size: 12Kb Insertion site: EcoRI 1c 16 and 6 Kb 1d E16 (1), S16 (2), S6 (1) 1e twice

2 Page 2 of 9 MIDTERM EXAM OF BIO/BPS Part V. Problems (Cont d) 2a B E E B Plasmid X B Plasmid Y 4 Insert size: 1.0 Kb 2b Insertion site: EcoRI A (5) C 6.0Kb A (11) B (14) 3a C(2.6) 3b 2.2 Kb band with probe 2 3c Probe: 2 Enzymes: S + C Sizes:1.5, 1.3, 0.7Kb

3 Page 3 of 9 MIDTERM EXAM OF BIO/BPS I. Practical component: (4 points) You have the following three solutions and solvent (water): A: 2.25M Tris-HCl B: 1.2mg/mL Bovine serum albumin C: 6% (m/v) Coomasie blue Initially add the appropriate volume of 2.25M Tris-HCL to 700µL of water to obtain a final concentration of 150mM Tris-HCl. To this solution (150mM Tris-HCL) add the required volumes of bovine serum albumin and coomasie blue to obtain the following final concentrations: 100µg/mL bovine serum albumin and 0.3% (m/v) coomasie blue. II. Calculations: (Indicate your answers to two digits after the decimal; 16 points) 1. What mass of water is contained in 160 grams of 22.0% (m/v) KCl solution (Density of solution: 1.1 g/ml)? 2. The density of a 7.50% (m/m) solution of ammonium sulfate, (NH 4 ) 2 SO 4, is 1.04 g/ml. What mass of (NH 4 ) 2 SO 4 would be required to prepare 750 ml of this solution? 3. You wish to prepare 1.2L of a (10% m/v) solution of NaCl from a 12% (m/v) stock solution. What volumes of water and of the NaCl stock solutions are required to prepare the desired solution? 4. You add 1mL of water to 5mL of a 0.30% (m/v) solution of gentamicin. What is the concentration in g/l in the diluted solution? µL of a DNA solution of unknown concentration are added to 100µL containing 50µg of DNA and 150µL of water. The resulting DNA concentration in the final solution was 0.11µg/µL. What must have been the absorbance at 260nm of the DNA solution of unknown concentration? 6. A solution is prepared by mixing 100 ml of 2M NaCl, 100 ml of 1M CaCl 2 and 650 ml of water. What is the molar ratio of Ca:Cl:Na in the final solution? mL of solvent is removed by evaporation from 750 ml of a 0.50 M sodium chloride solution. What volume of water needs to be added to the evaporated solution to obtain a final concentration of 0.25 M NaCl?

4 Page 4 of 9 MIDTERM EXAM OF BIO/BPS You have two plasmid preparations A and B (illustrated below) each at concentrations of 100ng/µL. You wish to subclone a 1.5 Kbp EcoRI fragment from plasmid A into the unique EcoRI site of a 3.0Kbp vector B. EcoRI 1.5 Kbp EcoRI EcoRI Total size 7.5Kbp A Total size 3.0Kbp B Complete the following table to indicate the volumes of each ingredient required for the preparation of a 50µL ligation mixture containing 50ng of vector and an amount of digested plasmid B required to have an insert to vector ratio of 3 : 1. Ingredient EcoRI digested plasmid A Volume (µl) 50ng EcoRI digested Plasmid B 5X ligation buffer 10 T4 DNA ligase 1 Water

5 Page 5 of 9 MIDTERM EXAM OF BIO/BPS III. Bioinformatics (1.0 point/question) 1. What is the chance that the gene identified by Blast using the following query sequence represents a false positive? GCTGATTGTTTGATCCCGATTGAACAAAAGCTGCCGTAGGCATTTTGGGCTCTCGATTGAATCC AAGTTCCCCAACCCATTTTCCAAAAAGGTTTGAAAACTTGAAAAACGTCCTGGGAACTGGACTT 2. How many AluI and HpaII restriction sites are there in the sequence with the accession number FJ230967? 3. Which two of the following primers would allow the amplification of at least 200bp of the sequence with the accession number FJ230967? What would be the size of the amplicon? (a) GAATTCGACGTTCGGACAGCGTGAC (b) TACAGGGTGGAGCAAGCTTGGCAGG (c) TAGCCGAACCTGCCAAGCTTGCTAG (d) AACCCATAGCCGAACCTGCCAAGCT 4. A pair of primers was used to amplify the complete sequence with the accession number FJ The forward primer included an XbaI restriction site and the reverse primer included a SmaI restriction site. The XbaI-SmaI digested amplicon was then cloned into puc19 digested with XbaI and SmaI. Fragments of what sizes would be expected after a complete digestion of the recombinant plasmid with HindIII? 5. Obtain the inverse complement of the sequence corresponding to the accession number FJ Obtain the complement sequence of the resulting sequence. Now obtain the inverse sequence of the last sequence obtained. Indicate the first six bases of the final sequence.

6 Page 6 of 9 MIDTERM EXAM OF BIO/BPS IV. Theory (1.0 point/question) 1. You wish to amplify part of the following single stranded sequence using the primers indicated below. How many copies of the double stranded amplicon, which is delimited by the primer sequences, would you have after 10 cycles if you started with 100 copies of the original template sequence? 5 -TCGTTTGGAAAACGTTAATATCATCATTTGGCATGACGATTGCAGGATACTTTCAGCCA-3 Primers: 5 -TCGTTTGGAAAACG-3 and 5 -ATCCTGCAATCGTC-3 (a) copies (b) copies (c) copies (d) copies 2. TBLASTn allows you to perform a search of...? (a) A protein database with a translated nucleotide query. (b) A translated nucleotide database with a protein query. (c) A translated nucleotide database with a nucleotide query. (d) A protein database with a protein query. 3. Complete the blanks in the following sequence to generate a palindrome, which could represent a potential restriction site. (Note: each blank represents a single nucleotide) 5' T CT GT 4. The enzyme FraII cleaves palindromes of the sequence Y NATNR. How many different palindromes can be cleaved by FraII? (Y= T or C, R = A or G) 5. The rate at which DNA migrates through an agarose gel is determined by: (a) Molecular size of the DNA and the agarose concentration. (b) Conformation of DNA and the applied voltage. (c) The length of the agarose gel and the negativity of the DNA. (d) A and B (e) A and C

7 Page 7 of 9 MIDTERM EXAM OF BIO/BPS V. Problems: Answer 2 of the 3 following problems (5 points/problem) 1. Panel A: Calibration of a novel restriction enzyme; BraI. The restriction activity of a preparation of the BraI enzyme was evaluated with reaction mixtures containing 1µg plasmid DNA and 1µL from serial 2 fold dilutions of the enzyme preparation. All reactions were incubated for one hour under appropriate conditions and then fractionated on a gel. Panel B: Restriction enzyme analysis of a recombinant plasmid. The first lane represents the undigested recombinant plasmid (UD). Lanes 2-4 represent the recombinant plasmid digested with ClaI (C), EcoRV (E) and SphI (S) respectively. The last lane represents only the vector digested with XbaI. Fragment sizes in kilobase pairs are indicated besides each band. A 1/500 1/256 1/128 1/64 1/32 1/16 1/8 1/4 1/2 B UD C E S V + X (a) According to the results in panel A, what is the concentration in units/µl of BraI in the undiluted enzyme preparation? (b) According to panel B, the recombinant plasmid has a DNA insert with a size of inserted in the restriction site of the vector. Kpb (c) According to panel B, which fragment sizes represent intermediate products resulting from a partial digestion? (d) How many sites remain to be digested in the intermediate products identified in (c)? Indicate the sizes of the intermediate products and the number of cut sites which remain to be digested in parentheses. (ex. 7Kb (3)) (e) How many times does EcoRV cut the ClaI fragment?

8 Page 8 of 9 MIDTERM EXAM OF BIO/BPS You cloned your favorite gene, TGIF, into a circular bacterial plasmid pnim. You identify two recombinants, plasmid X and plasmid Y, that contain the TGIF gene inserted in pnim. You digest all three plasmids (pnim, plasmid X, and plasmid Y) with EcoRI, BamHI, or both restriction enzymes together. All digestions were complete and gave the following results: pnim Plasmid X Plasmid Y EcoRI BamHI both EcoRI BamHI both EcoRI BamHI both 7.0 kb 4.0 kb 4.0 kb 7.0 kb 4.0 kb 4.0 kb 7.0 kb 4.0 kb 4.0 kb 3.0 kb 2.0 kb 1.0 kb 2.8 kb 2.0 kb 1.0 kb 2.2 kb 2.0 kb 1.0 kb 1.2 kb 1.0 kb 1.8 kb 1.0 kb 0.8 kb 0.8 kb 0.2 kb 0.2 kb (a) On the templates provided, draw possible restriction maps of plasmids X and Y which are in agreement with the results presented. Your maps must indicate which restriction sites are in the vector (thin line) and which restriction sites are in the insert (thicker line) as well as the relative distances between the restriction sites. Below the templates, indicate the size of the insert and the insertion site within the vector. (b) A linear DNA fragment was digested with enzymes A, B, and C. The following table indicates the fragment sizes obtained following complete digestions. Enzymes Size of fragments (Kbp) A 11, 6, and 5 B 14 and 8 C 16 and 6 A + B 8, 6, 5, and 3 A + C 11, 5, and 1 B + C 8 and 6 Draw a restriction map on the template provided which would be in agreement with the pattern of fragments obtained. Indicate the relative distance between each of the restriction sites. Note the position of restriction site C is indicated.

9 Page 9 of 9 MIDTERM EXAM OF BIO/BPS You cloned and sequenced a 5 Kbp gene obtained from the zebra fish genome. An analysis with NEB cutter generated the following map: S(0.2) C(1.0) K(1.3) C(2.3) C(2.6) S(3.0) K(3.4) C(4.5) Probe 1 Probe 2 The letters S, C, and K represent the restriction sites SpeI, ClaI, and KpnI, respectively and the numbers in parentheses represent the positions on the map in Kbp from the origin. (a) To verify the computer generated map, you isolate zebrafish genomic DNA, perform restriction digestions, separate on a gel, and then hybridize the gel with one of two probes indicate#d above. The sizes of the bands observed on the Southern hybridization are indicated in the table below. Enzyme Probe 1 Probe 2 Cla1 1.3 and and 2.2 KpnI and 8.0 SpeI These results indicate that the computer-generated map is in error. Which restriction site (s) on the computer generated map is (are) possibly wrong? Indicate the site (s) and it's (their) position (s) in parentheses. (b) Which band size (s) observed on the Southern was (were) unexpected? (c) To confirm the error, you wish to repeat the southern hybridization on a double digest of genomic DNA. A double digest with which enzymes would allow you to confirm the error? Indicate the probe that would be used and the band size (s) expected if the site (s) are truly erroneous.