Genomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two

Transcription

1 Supplemental Materials and Methods Genomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two upstream regions of the human Klf9 gene (-5139 to bp and to bp) were subcloned into pgl4.23 (Supplemental Table 3) for testing in HEK293-hMR+ cells. As a positive control we used a 626 bp fragment of the upstream region of the human glucocorticoidinduced leucine zipper (GILZ) gene (-1286 to bp) cloned into pgl4.23; this region of the GILZ gene was previously shown to contain at least two functional GRE/MREs [48]. We cultured and transfected HEK293-hMR+ cells as described previously [28]. We incubated cells for 5 h in the presence or absence of 10 nm ALDO with or without 1 µm of the MR selective antagonist RU26752 (Sigma). The vehicle DMSO was present in all wells at a final concentration of 0.01%. Luciferase activity in cell lysates was analyzed using the Dual Luciferase Reporter Assay (Promega) according to the manufacturer s protocol.

2 Supplmental Table 1. Oligonucleotide primers and probes (Taqman assays) used for quantitative real time PCR analysis of gene expression (RTqPCR) and chromatin immunoprecipitation (ChIP) assays. For RTqPCR mklf9 mrna Probe: 5 6FAM-AAAGTCTATGGAAAATCC 3 Forward: 5 GCACAAGTGCCCCTACAGT 3 Reverse: 5 TGTATGCACTCTGTAATGGGCTTT 3 mklf9 hnrna Probe: 5 6FAM-CTTCTGCACTGGTTTTAG 3 Forward: 5 CGTATAGCTGTTTGAGGTCCATAGTT 3 Reverse: 5 CCTGGCCTCGTCTCAGAAATT 3 For ChIP assay mklf9 GRE/MRE-6.1 (-6134 to relative to the TSS): Probe: 5 6FAM- TTCTGACTCACCCAGAGGGCCG 3 Forward: 5 AAGGACAAACTGTTCCACAACAAC 3 Reverse: 5 CCCCCCGAGTATGGTTCTG 3 mklf9 GRE/MRE-5.3 (-5232 to relative to the TSS): Probe: 5 6FAM- ACCTGCCTCCTCCGGCTGCTG 3 Forward: 5 AGAACTGGGACTGTCCTCAAATG 3 Reverse: 5 TGGCATCGCCCTTTTAAAAA 3 mklf9 intron ( to relative to the TSS): Probe: 5 6FAM-CTTCTGCACTGGTTTTAG 3 Forward: 5 CGTATAGCTGTTTGAGGTCCATAGTT 3 Reverse: 5 CCTGGCCTCGTCTCAGAAATT 3 TSS transcription start site

3 Supplemental Table 2. Oligonucleotides used for construction of pgl4.23 reporter plasmids, DNAseI footprinting and electrophoretic mobility shift assay (EMSA). PCR primers used to amplify genomic DNA for subcloning into pgl4.23 promoter mklf9 GRE/MRE-6.1(634 bp) Forward: 5 atactcgaggactaggggcttaag 3 Reverse: 5 ataaagcttcggccaggctgtgcga 3 mklf9 GRE/MRE-5.3 (179 bp) Forward: 5 atactcgagtccttgcacgagtttggg 3 Reverse: 5 ataaagctttttaaaaagtcttccgc 3 mklf9 fragment containing the two GRE/MREs at -6.1 and -5.3 (1269 bp) Forward: 5 ataagatctgactaggggcttaagggg 3 Reverse: 5 ataaagctt GCCTGGCATCGCCCTTT 3 PCR primers used for site-directed mutagenesis of pgl4.23 reporter plasmids mklf9 GRE/MRE mut: AGGACAaacTGTTCA mutated to GAATTCaacTGTTCA Forward: 5 GGAGACGGGTGGGAGGGGGGTAAAAGAATTCAACTGTTCCACAACAACCACAG 3 Reverse: 5 CCTGTGGTTGTTGTGGAACAGTTGAATTCTTTTACCCCCCTCCCACCCGTCTCCA 3 mklf9 GRE/MRE mut: AGGACAaacTGTTCA mutated to AGGACAaacGAAAAA Forward: 5 GGAGGGGGGTAAAAAGGACAAACGAAAAAACAACAACCACAGGAAACACAGC 3 Reverse: 5 AGGGCTGTGTTTCCTGTGGTTGTTGTTTTTTCGTTTGTCCTTTTTACCCCCCTCCC 3 mklf9 GRE/MRE-5.3 mut: AGGGCAgttTGTTCA mutated to ACCTCAgttGAATCA Forward:5 GCGGATTCCTCGTCCCCCAATCTACCTCAGTTGAATCAACTGCAGCAAAG AGAG 3 Reverse: 5 AGCTCTCTTTGCTGCAGTTGATTCAACTGAGGTAGATTGGGGGACGAGGAATCC 3 PCR primers used to generate fluorescent-labeled DNA for DNAseI footprinting Forward: FAM or HEX 5 TCCTTGCACGAGTTTGGG 3 ; Reverse: 5 ATCGCCCTTTTAAAAATCT 3

4 Supplemental Table 2, continued EMSA probes mklf9 GRE/MRE-6.1 Sense: 5 gatcaaaaggacaaactgttccaca 3 Antisense: 5 gatctgtggaacagtttgtcctttt 3 mklf9 GRE/MRE-6.1 mut Sense: 5 gatcaaagaattcaacgaaaaaaca 3 Antisense: 5 gatctgttttttcgttgaattcttt 3 mklf9 GRE/MRE-5.3 Sense: 5 gatcaatctagggcagtt TGTTCAACTGCAGCAAA 3 Antisense: 5 gatctttgctgcagttgaacaaactgccctagatt 3 mklf9 GRE/MRE-5.3 mut Sense: 5 gatcaatctacctcagttgaatcaactgcagcaaa 3 Antisense: 5 gatctttgctgcagttgattcaactgaggtagatt 3 MMTV GRE Sense: 5 gatcgttgggttacaaactgttctaacca 3 Antisense: 5 gatctggttagaacagtttgtaacccaac 3 PCR primers for site directed mutagenesis were designed using the QuickChange Primer Design tool (Agilent). Shaded nucleotides represent introduced mutations in the GRE/MRE halfsites. Lower case letters represent restriction sites for subcloning into pgl4.23 or non-native nucleotides added to the 5 ends for [ 32 P] labeling by Klenow fill-in (for EMSA).

5 Supplemental Table 3. Oligonucleotides used for PCR amplification of human genomic DNA for subcloning into pgl4.23. hklf9 GRE/MRE-5.5 Fragment1 (632 bp) Forward: 5 acatctcgaggcatgggggccgtacagaagggggaact 3 Reverse: 5 acataagcttcggccaggctgtgcgggaggagatg 3 hklf9 GRE/MRE-4.0 Fragment2 (336 bp) Forward: 5 acagagctcgcccctgggtgttagctgtcattat 3 Reverse: 5 acatctcgagccaggcgggaaggaaggaggagaac 3 hgilz control to (626 bp) Forward: 5 acatctcgagaacattgggttccaccacata 3 Reverse: 5 acataagcttcagggaattctgataccagtta 3 Lower case letters represent restriction sites for subcloning into the pgl4.23 vector.

6 Supplemental Figure Legends Supplemental Fig 1. Treatment with 3,5,3 -triiodothyronine (T 3 ) caused dose and timedependent increases in Klf9 mrna in HT-22 cells. Cells were treated with 30 nm T 3 for different times (A; F (5,23) =37.90, p<0.00; ANOVA), or with increasing doses of T 3 for 4 h (B; EC50= 1.87 nm; (F (7,31) =77.09, p<0.001; ANOVA) before harvest and analysis of Klf9 mrna. In each experiment cells were treated with the hormone doses for the times indicated before cell harvest, RNA extraction and analysis by RTqPCR. Klf9 mrna was normalized to the mrna level of the housekeeping gene GAPDH. Bars represent the mean + SEM (n=4) and letters above the means indicate significant differences among hormone concentrations or time point (means with the same letter are not significantly different; Tukey s pairwise comparison test; P<0.05). Supplemental Fig.2. Klf9 is predominantly regulated by the GR in HT-22/MR16 cells. We cultured HT-22/MR16 cells with vehicle (No hormone), CORT (25 nm) or ALDO (25 nm) with or without the GR-selective antagonist RU486 (500 nm), the MR-selective antagonist SPR (500 nm) or RU486 plus SPR. Cells were incubated with antagonists for 1 h before the addition of vehicle or hormone, and hormone treatment was continued for 4 h before cell harvest, RNA isolation and analysis of Klf9 mrna by RTqPCR. We normalized Klf9 mrna to the housekeeping gene GAPDH which was unchanged by hormone or antagonist treatment (data not shown). Bars represent the mean + SEM (n=4) and letters above the means indicate significant differences among the antagonist treatments within a hormone treatment (means with the same letter are not significantly different; Tukey s pairwise comparison test; p<0.05). 1

7 Supplemental Fig 3. Identification of an aldosterone-responsive region of the human Klf9 gene centered at ~-5.5 kb relative to the transcription start site. We co-transfected HEK293- hmr+ cells with promoter-luciferase constructs containing fragments of the human Klf9 gene and the prenilla plasmid, and measured luciferase activity after 5 h treatment with 10 nm aldosterone (ALDO) in the presence or absence of 1 µm of the MR-selective antagonist RU Fragment 1 encompassed 632 bp from to bp, and fragment 2 encompassed 336 bp from to bp upstream of the human Klf9 transcription start site. A 626 bp fragment of the upstream region the human glucocorticoid-induced leucine zipper gene (GILZ) that contains at least two GRE/MREs served as a positive control for hormone activation, and the pgl4.23 empty vector served as the negative control. Luciferase activity was measured using the Dual Luciferase Reporter Assay. Bars represent the mean + SEM (n=8) and letters above the means indicate significant differences among treatments (means with the same letter are not significantly different; fragment 1: F (2,41) =693.5, p<0.001; fragment 2: F (2,41) =10.92, p<0.05; GILZ: F (2,41) =1130, p<0.001; empty vector: F (2,41) =7.197, p<0.01; ANOVA). Supplemental Fig.4. Corticosterone activates a fragment of the mouse Klf9 gene containing the GRE/MRE-6.1 and GRE/MRE-5.3. We transfected HT-22 cells with enhancer-luciferase constructs containing a fragment of the mouse Klf9 gene that encompassed GRE/MRE-6.1 to GRE/MRE-5.3, or constructs containing only the single GRE/MREs (shown in figures 4 and 5). Cells were co-transfected with prenilla, then incubated overnight before treatment with 100 nm CORT for 4 h followed by harvest and dual luciferase assay. Bars represent the mean + SEM (n=5). Asterisks indicate statistically significant differences between vehicle (Control) and CORTtreated cells for each enhancer-reporter construct (*, P<0.05; **, P<0.0001; Student s t test). 2

8

9

10

11