III. CLONING TREHALOSE SYNTHASE GENE from Thermobifida fusca and Mycobacterium tuberculosis

Transcription

1 23 III. CLONING TREHALOSE SYNTHASE GENE from Thermobifida fusca and Mycobacterium tuberculosis 3.1 Introduction This chapter concentrated to provide the clone of the gene (TreS) within cloning vector and within plant expression cassette as a preparation to express the gene in Arabidopsis thaliana to assess the effect of the gene in plant responses to stresses. There are many TreS bearing organisms, such as bacteria and fungi. The gene that is going to be cloned, would be expressed in the plant, hence, enzymes that active in the condition about similar to the cellular plant condition would be favorable. Few enzymes with their condition for optimum activities are presented in Table 1. Codon usage is also necessary to be considered to maximize the expression of the gene. Some comparisons of codon usage are presented on appendix 1. Information was gathered regarding to the characterisstics (ph, temperature, Km) of trehalose synthase from few organism that has been reported. It is shown on appendix 1 that among trehalose synthases reported, those with low Km and high maximum conversion rate at the condition suitable in the plant cells would be favourable to be express in plant. TreS gene from Thermobifida fusca, has optimum temperature of 25 and ph 6.5 and it s activity is not affected by the concentration of substrate (Wei et al. 2004). Hence, this enzyme was chosen to be expressed in Arabidopsis thaliana. It was also cloned TreS from Mycobacterium tubercolusis (Murphy et al. 2005) as it s sequence is very similar to that of Thermobifida fusca. 3.2 Materials and Methods Place and time of research This experiment was conducted in The Department of Molecular Plant Physiology, Utrecht University, Netherlands, started from September 2004-March Materials TreS gene source, lyophilized Thermobifida fusca (cat No ) was purchased from Deutsche Summlung von Mikroorganismen und Zelkulturen (DSMZ), Germany and TreS gene from Mycobacterium tuberculosis inserted in

2 24 plasmid (pcr Blunt II TOPO) was kindly donated from B. Rebertson (Imperial Collage, London, UK) Cloning of TreS genes from Thermobifida fusca and from Mycobacterium tuberculosis Growth condition of Thermobifida fusca and DNA isolation Lyophilized cells of the bacteria received in tablet was dissolved in sterile water and spread on top of solidified 65 medium ph 7.2 [glucose 4 g/l; yeast extract 4 g/l; malt extract 10 g/l; CaCO3 2g/L (omit if liquid medium is needed) and 12 g/l agar]. The culture was incubated at 55 o C as suggested by DSMZ. When grown cells were obtained, DNA was isolated using plant DNA extraction kit, Pure Nucleophyton (Qiagen). Cloning strategy TreS gene was isolated using PCR cloning approach with forward primer: 5 -GAG CCA TGG AGA AGT CGA TGA CCA C-3 and reverse primer: 5 -TGG AAG CTT TCA GGA CG CTG GGT C-3. These primers were spanned outside the TreS gene within the genome. Optimum annealing temperature was determined using PCR program with gradient annealing temperature as follow: 1x cycle of 94 o C for 5, followed by 40x cycles of 94 o C, 30 ; o C, 30 and 72 o C, 2 ; then 1x cycle of 72 o C for 5. The PCR product reaction mixtures then were run on 0.8% gel electrophoresis at 90 volt for about 30 minute. The gel was subjected to UV transiluminator to see the DNA fragments on the gel. The optimal temperature determined from the gel was used for all PCR work. The right fragment of PCR product was eluted using DNA gene clean kit QIAEX II (Qiagen). The eluted DNA then was inserted into pgemt Easy Vector System I (Promega) with ligation mixture: 2X ligation buffer 4 µl, eluted DNA 2 µl, pgemt vector 1 µl and enzyme T4 DNA lygase 1 µl. After over night incubation at room temperature, the mixture then was transformed into competent cells of E. coli DH5α using Heat Shock transformation method. Ligation mixture of a 1.5 µl was added to micro tube contained of 100 µl competent cells (CaCl 2 ) and incubated in ice for 1 h before transferring to 42 o C water bath for 2 minute. The tube then was immediately transferred to ice and kept for 15 minutes. Luria Broth (LB) medium was added to the tube, incubated at 37 o C for 1 h. A 100 µl of suspension cells was plated on solidified LB medium supplemented with 100

3 25 mg/l amphycilin. The rest of suspension cells were centrifuged and about 100 µl of supernatant was kept for resuspension before plating on the same medium. The culture was incubated at 37 o C, and colony number was recorded after 24 h. To verify whether the colonies bring the right plasmid with the right gene, 6 colonies were reanalyzed. These colonies were grown on 3 ml liquid culture supplemented with 100 mg/l amphycilin and incubated at 37 o C for overnight. Plasmid was then re-isolated using alkali lysis (Sambrook and Russel, 2001) and digested using EcoRI to see the right size of the gene, or using PstI to see the orientation of the gene and also to give another prove for the right gene. Two clones among those that contained the right TreS gene were re-grown in the same medium and the plasmid were re-isolated using Jet Quick Miniprep Spit Kit (Qiagen) to provide a high quality of plasmid DNA. DNA concentration was determined using spectrophotometer at 260 nm. The DNA then was sequenced with the sequencing mixture as follow: DNA plasmid 1.2 µg, 10 pmol Primer forward (as used to obtain the gene) or 10 pmol M13 primer and then adjusted volume using deionized water to 16 µl final volume. To obtain the whole gene sequence forward or reverse internal primers were also used. This mixture then was sent to commercial sequencing company at Utrecht University. Verifying TreS from Mycobacterium TreS gene from Mycobacterium that has been inserted in plasmid pcr Blunt II TOPO was kidly donated from B. Robertson. The plasmid was retransformed into E.coli, and after overnight culture the plasmid was re-isolated from cells. Restriction analysis was performed to recheck whether it bears the right gene. Digestion using NdeI/XhoI was done to check the size of the gene and BamHI or EcoRI to see the orientation of the gene and give more prove for the right gene. The digestion mixture was then run on 0.8% gel electrophoresis at 90 volt for about 30 minutes. Insertion of TreS gene to Plant Expression Vector Plant expression vector used was pbin1935s provided by Utrecht University. This plasmid was derived from pbin19 that all the multiple cloning site has been removed using HindIII and EcoRV. The sticky ends resulted then were filled using klenow fragment to produce blunt ended fragment. Promoter of 35S and multiple cloning sites from puc19 was excised from PUC19 using EcoRV,

4 26 and klenow fragment was subjected to this fragment to obtain blunt ended fragment. pbin19 fragment and 35S promoter-multiple cloning site from PUC19 was then ligated to create pbin1935s plasmid. TfTreS that was available in pgemt easy vector system I was digested using EcoRI and was eluted from gel using QIAEX II (Qiagen). At the same time, pbin1935s was digested using EcoRI and then was treated with alkaline phosphatase for 30 minutes. The gene fragment and the vector was ligated for overnight, followed by transformation to CaCl 2 E.coli competent cells using heat shock transformation method as the same method mentioned before. The cell suspension then was plated on agar solidified LB supplemented with 50 mg/l kanamycin. Colonies obtained was observed after over night culture and 20 colonies were chosen to be re-analyzed whether they have the right plasmid with the right gene at the right orientation. Plasmid isolated from over night liquid culture then was digested using EcoRI to see the size of the gene, and using BamHI to see the orientation of every clone. Plasmids that produced about 2000 bp fragment when digested with EcoRI and about 1100 bp fragment when digested using BamHI were the expected one. MtTreS was exciced from plasmid PCR Product Blunt II TOPO using XbaI/SacI. The digestion mixture was verified on 0.8% gel electrophoresis. Fragment DNA about 2000 bp was eluted from gel, and ligated with pbin1935s that has been digested with XbaI/SacI and treated with alkaline phasphatase for 30 minutes. The ligation mixture was transformed into E.coli, and the clones obtained were reanalyzed using BamHI. 3.3 Result and Discussion Cloning trehalose synthase gene (TreS) from Thrmobifida fusca This research was started by growing Thermobifida fusca that was purchased from DSMZ Germany. The lyophilized material was dissolved in water and spread at solidified 65 medium at 55 o C. DNA was isolated from mycelium and PCR was done in various annealing temperature to obtain the optimal annealing temperature, the result is presented at Figure 5. The figure shows that there is no amplification resulted from control (no DNA) and bands in different thickness resulted from different annealing temperature. The length of the original gene is 1830 bp. However, the primers were designed outside the gene to get the whole gene. Band about 2000 bp in

5 27 size shown in the figure should be the TreS gene. It is shown that TreS can be amplified at 43 o C up to 58 o C annealing temperature, however, the temperature ranged from o C seems to be the optimal annealing temperature. Further PCR works were done at 53 o C annealing temperature. This PCR product then was eluted using QiaexII (Qiagen), the result is presented in figure 4B. The purified DNA (6 ng/µl of the mixture) was ligated with pgemt Easy Vector System I (1 µl) followed by transformation to E. coli DH5α competent cells with reaction mixture DNA : competent cells = 1.5 : 100 µl. It was obtained 100 colonies of putative transformed cells from 100 µl transformation mixture and uncountable colonies were found from 900 µl the remaining transformation mixture. While from the control cell, 11 and 50 colonies M Control (no DNA) M A ET DNA template TreS band (2000 bp) Eluted TreS (2000 bp) B Figure 5: PCR Product at various annealing temperature and its eluted DNA. Optimum annealing temperature (box) is high lighted (A). First raw is control (water template) second row is PCR product of DNA sample. Eluted PCR product at 53 o C annealing temperature (B). M = molecular marker, ET= the eluted TreS.

6 28 were obtained from a 100 µl and 900µ reaction mixture respectively. From the results, we can see that the efficiency transformation/ligation was approximately 100 Colonies / ng DNA, and, each colony has 90% probability to contain TreS. The plasmid with the insert then was annotated as pgemtres with schematic diagram shown in Figure 6. The non-transformed colonies ( 10%) possibly resulted from T overhang of the vector that has been broken and self ligation occurred. Cloning sites pgemt T7 Apa I Aat II Sph I BstZ I Nco I BstZ I Not I Sac II EcoR I Spe I EcoR I Not I BstZ I Pst I Sal I Nde I Sac I BstX I Nsi I SP6 1 Start Sac II 200 Pst I 766 Sac I 829 Sac I 1103 BamH I 1136 Sma I 1680 Sma I 1830 Figure 6: Schematic diagram of pgemtres (pgemt with TreS gene as the insert). Cloning sites of pgemt are indicated. Restriction sites of TfTreS are also indicated. T7 and SP6 are the promoters and arrows indicate the direction of promoters.

7 bp M bp 2838 bp 1700 bp A M bp 800 bp 440 bp 247 bp 5077 bp M B C Figure 7. Restriction analysis of plasmid isolated from E. coli colonies expected to bear TreS gene. Plasmid isolated digested with EcoRI (A), using PstI (B) and using BamHI (C). Number of each well is an annotation for the clone used. Blue arrows indicated the fragments that were expected to be the right size when cut using the corresponding enzymes. From the putative transformed colonies, six colonies were analyzed to verify the presence of TfTreS The right size of the gene was verified using EcoRI. In order to have idea of the right sequence and to see their orientation they were digested using BamHI and PstI (see analysed Figure 7). These enzymes were chosen based on the sequence of TfTreS gene analyzed with computer analysis in term of enzymes that may or may not cut as well as those that cut frequently (figure 7). Hence, as it was expected that using EcoRI the original size about a

8 30 (2000 bp) would be obtained, while using BamHI, single band of about 5000 bp was produced, since this enzyme cut once only within the gene. Figure 8. Restriction analysis based on computer simulation of TreSTf sequence. Cutting with PstI, 2 profiles of bands were obtained, 1) bands of about 1800 bp and of about 3300 bp were shown when the start codon spanned near T7 promoter, and, 2) a band of about 300 bp and of about 5000 bp were obtained if the start codon spanned near SP6 promoter. From the picture, it can be seen that the resulted bands from any restriction enzyme appeared to be the right size as expected. Hence, this gene should be the TreS from Thermobifida fusca. This result confirmed with sequence analysis (Figure 9). We found, however, there was a point mutation both clones at base 27 th (the third base of the 9 th codon) from GGC TO GGG and at base 1406 from GCT to GCC, fortunately, those codons encode for alanine. The clone number 9, however, another point mutation occurred at base of 1257 from GGA to GGG (both for glycine), and, hence these silent mutations should not alter properties of the protein. Regarding to codon usage, there were slight increase of the first point mutation (from 6.5 to 8.1%), and the third mutation shift the codon usage from 8.1 to 20.2%. While the second mutation, there was dramatic decrease of codon usage from 31.8 to 8.5%. Whether these mutations affect protein activity, it would be discussed in session 6 (characterization of transgenic line). From the analysis conducted, we could conclude that TreS from Thermobifida fusca has been successfully inserted in pgemt and cloned in E.coli. This gene, hence, was ready to be inserted to plant expression cassette, in this case pbin1935s that readily available in the laboratory was used. After being chopped from pgemt using EcoRI and re-eluted from gel, TfTreS was ligated with pbin1935s that has been digested using the same enzyme and treated with alkaline phosphatase. This ligation produced a new plasmid called pbin1935stftres with schematic diagram as shown in Figure 10. The ligation

9 31 mix mixture then was transformed into E.coli. Uncountable colonies were found and 20 of each clone were verified using EcoRI and BamHI (Figure 11) to see if the right gene was inserted and if insertion was in the correct orientation. GCC the 27 th ATGACCACACAGCCGGCTCCTGGTGCGCGCCCGACGCCGACCGGGTCCGTTC CCGACACGTTCACCCACGCAAAGCCGCGCGACCCCTACTGGTACAAGCACGCG GTGTTCTACGAAGTCCTCGTCCGCGGCTTCTACGACTCCAACGGGGACGGCAC CGGCGACTTGCGGGGCCTCATCGAAAAACTGGACTACCTGCAGTGGCTCGGCA TCGACTGCCTCTGGCTGCTGCCGATCTACGAGTCCCCGCTCCGCGACGGC GGCTACGACGTCTCCGACTACATGAAGATCCTGCCCGAGTTCGGCCGGATCTC CGACTTCGTGGAACTCGTCGAAAAAGCCCACCAGCGGGGCATCCGGGTCATCA CCGACCTGGTCATGAACCACACCAGCGACCAGCACCCGTGGTTCCAAGCCTCC CGGCACGACCCCGACGGACCTACGGCAACTTCTACGTCTGGTCGGACACCACG GAACGTTACAGCGACGCGCGCATCATCTTCATCGACACCGAGCAGTCC AACTGGACCTACGACGAAGTGCGCGGACAGTACTACTGGCACCGCTTCTTCTC CCACCAGCCCGACCTCAACTTCGAGAACCCGGACGTCCAGGACGCCATCCTCG AAGTGATGCGGTTCTGGCTGGACCTTGGCATCAGCGTTTCCGCTTGGAGCCCG TGCCCTACCTGTACGAGCGGGAAGGCACGAACTGCGAGAACCTCAAGGAGACC CACGAGTTCCTCAAACGCATCCGCGCCGAAGTCGACCGGCTCTACCCC GACCGGGTCCTGCTCAGCGAAGCCAACCAGTGGCCCGCCGACGTCGTCGACT ACTTCGGCGACTACGAATCCGGCGGCGACGAATGCCACATGAACTTCCACTTC CCGCTGATGCCGCGCATGTTCATGGCGGTCCGGCGCGAACAGCGCTACCCCAT CTCGGAAATCCTCGCGCAGACCCCGCCTATTCCGCGCAACTGCCAGTGGGCGA TCTTCCTGCGCAACCACGACGAGCTGACCTTGGAGATGGTCAAGCGATG AAGAGCGGGACTACATGTACTCCGAATACGCCAAAGACCCGCGGATGCGCGCC AACATGGGGATCCGCCGCCGGCTGGCACCCCTCCTGGAAAACGACCTCAACCA GATCAAACTGTTCACCGCGCTGCTGCTGTCGCTGCCCGGCTCCCCGGTGCTCT TACTACGGCGACGAGATCGGGATGGGCGACAACATCTGGCTGGGGGACCGCG ACAGCGTGCGCACCCCATGCAGTGGACCCCGGACCGCAACGCCGGATTCTC GGG the 1257 th CCGCTGCGACCCGGGCCGCCTCTACCTGCCGGTGATCATGGACCCGATCTACG GGTACCAGGCGATCAACGTCGAAGCACAGCAGAACAACCCGAACTCTGCTGCT GAACTGGACCCGCAACATGATCCAGATCCGCAAGCAGCACCCGGTGTTCGGGA CGGGGGACTTCACCGAACTCCACGCGAGCAACCCCAGCGTGTTCGCGTTCGTG CGCGAATACGGCGACGACCGGATGCTGTGCGTCAACAACCTGTCCCG GCC The 1406 th GTTTCCCCAACCGGTGGAACTGGACCTCCGCCGCTTCGAAGGGATCACCCCGA TCGAATGCACGGGGGGAGTGCACTTCCCGCCCATCGGGGAACTGCCCTACCTG CTGACTCTCCCCGGGCACGGCTTCTACTGGTTCCAGCTTCCGCCCGTCGCCGA AGAGCAGCCGCTCGCCCAGCCCGTCACCACCGTCCCCGCAGCCCCGCAGCCT CCTGCTCCGGCAGACCGTCCCGCGTCCGACCCGACCCAGCGGTCCTGA Figure 9: Sequence of TreS from Thermobifida fusca cloned in E. coli. The sequence confirmed the original sequence published in Web site (Wei et al 2004) but some silent mutation occurred at sites indicated. Number within boxes annotated the base position in the gene.

10 32 tnos pnos pbin1935stftres Figure 10. Schematic diagram of pbin1935stftres (14400 bp). Restriction site available in the gene and in the vector are shown. The result showed that using EcoRI, 1 band of the entire gene about 2000 bp and another band of about bp were obtained. While using BamHI, 2 possible band profiles 816 were shown (Figure 11). One band of 1100 bp in size beside a single big band was obtained when the TfTreS start codon spanned just behind CaMV35S promoter. Otherwise, a band of 750 bp beside a large single band was also obtained when the start codon spanned just before the terminator. From the figure (10), it can be seen that almost all clones analyzed contained insert with different profile when digested using BamHI, indicating different orientation of the gene within the vector. Clones that contained the right gene size with the right orientation are shown by blue arrow, such as clone no 918 and 816 (Figure 11A). The restriction analysis showed that the TfTreS is successfully inserted in plant expression cassette, pbin1935s and cloned within E. coli. Hence, it can be proceeded to be transformed into Agrobacterium as mediator of gene transfer into plant chromosome. It was used 1 µl plasmid DNA to be transformed into 100 µl Agrobacterium (LBA4404) competent cells, and about 50 and uncountable colonies were found on the plate of 100 µl and 900 µl ligation mixture respectively selected on medium supplemented with kanamycin and riphamphycin. While from the control plate (pbin1935s without insert), no

11 33 colonie was observed. Six colonies of each clone were reanalyzed using EcoRI and BamHI as done previously. The result (Figure 11 B and C) shown that the plasmid within Agrobacterium was still the same plasmid as found in E.coli. Hence, the Agrobacterium with TfTreS gene in plant expression cassette was ready to be introduced to plant bp M M 1100 bp 2000 bp M A 1100 bp M M B BamHI 1100 bp EcoRI 2000 bp C Figure 11. Restriction analysis of TfTreS inserted in the plant expression cassette of pbin1935s after being cloned within E.coli and Agrobacterium. BamHI (A) or EcoRI (B) were used to analyze the clones. Those with 2000 bp fragment when cut using EcoRI and those with 1100 bp fragment when cut using BamHI are the expected clones. Most of the clones contained the pbin1935stftres. Only 2 among the right clones were choosen to be transformed into Agrobacterium, (blue arrow = clone 18 derivated from clone 9 and annotated as clone 918; red arrow = clone no 16 derivated from clone no 8 and annotated as clone 816). Restriction analysis of the construct after being transferred into Agrobacterium tumefaciens of clone number 8 (C) and of clone number 9 (D) shiw the identical fragments among the samples resulted from BamHI and as well as shown with EcoRI restriction analysis confirmed the right clones. D Cloning trehalose synthase gene from Mycobacterium tuberculosis (TreSMt) Based on the sequence of the MtTreS restriction site available within the gene and within the vector (pcr-blunt II-TOPO), it was decided to verify the

12 34 recombinant plasmid using NdeI/XhoI, EcoRI and BamHI. Beside the vector, some fragments were obtained: the entire gene of about 2000 bp when the plasmid was cut using NdeI/XhoI; 1 fragment of 750 bp; 3 fragments at different length when BamHI and EcoRI were used respectively (Figure 12 A). These results confirmed that the gene within the vector was MtTreS. This gene then was M 1 2 BamHI EcoRI NdeI/XhoI A M B Figure 12. Restriction analysis of MtTreS within pcr Blunt II TOPO (A), 1-2 were profile of pcr Blunt II TOPO. Fragments resulted from restriction enzymes are indicated. Eluted of MtTreS after being Excised from its cloning vector (1-6), plant expression cassette, pbin1935s cut using XbaI/SacI (7-8) and 9 = pbin1935s uncut (B). re-excised from pcr Blunt II TOPO using XbaI/SacI in order to fit the cloning site of pbin1935s with the right orientation before inserted into the plant expression cassette. Fragment of the gene and the vector after elution from the gel were verified before ligation was made (see Figure 12 B). The ligation gave a construct with diagram presented in Figure 13 A, and annotated as pbin1935smttres.

13 35 tnos pnos A pbin1935smttres M BamHI B 750 bp M B BamHI C 750 bp M XbaI/SacI D 2000 bp Figure 13: Schematic diagram of pbin1935smtbc and its restriction analysis. The schematic diagram of pbin1935smttres is shown (A). Restriction sites within vector and within the gene are also indicated. Restriction analysis of the plasmid using BamHI after being cloned within E.coli (B), 1-8 = clones analyzed. A 750 bp fragment is an indicator of the right orientation of the gene within the vector. Restriction analysis of the plasmid after being cloned within Agrobacterium tumefaciens, using both XbaI/SacI that result a whole gene fragment of about 2000 bp (C) and using BamHI resulted a 750 bp fragment (D) indicates that the plasmid was remained after being cloned within Agrobacterium. Whell 1-4 = Clone no 1, whell 5-8 = clone no.4 and whell 9 = uncut pbin1935smtbc.

14 36 After ligation for overnight and transformed into E. coli, uncountable colonies were obtained from both 100 and 900 µl of ligation mixture layered on plates. A 4 colonies of each were analyzed as before (Figure 13 B). All clones analyzed (4 colonies each) contained the insert, with very light differences in fragment sizes resulted from BamHI cut, and 4 clones shown the most expected profile (1, 4, 7 and 8). Two clones, clone number 1 and 4 were chosen to be further transformed into Agrobacterium. Verification both plasmid after Agrobacterium transformation was done using BamHI and XbaI/SacI as previously. This restriction analysis showed the right size of the gene (about 2000 bp) was obtained using XbaI/ScaI, and fragment of about 750 bp indicated the right orientation obtained from BamHI cut. This result confirmed that the construct (pbin1935smttres) was remained after being transformed into Agrobacterium. Hence, construction of MtTreS in plant expression cassette has been achieved, and was ready to be introduced into plant. 3.4 Conclusion Gene encoding for Trehalose Synthase (TreS) from Thermobifida fusca and that from Mycobacterium tubeculosis have been successfully inserted within cloning vector (pgemt), and have been cloned within E.coli. Gene sequence of TreS from T. fusca confirmed the original TreS protein sequence with 2 silent point mutations at the DNA level in clone 8 and 3 silent point mutations in clone 9. Frequency of codon usage of the silent mutation is quite different from the published reference sequence. The genes from both T. fusca and M. tuberculosis were then inserted in a plant expression cassette and produced 2 plasmids annotated as pbin1935stftres, and pbin1935smttres. These plasmids have been transformed to Agrobacterium and ready to be introduced to plants.