Exam 2 Bio200: Cellular Biology Winter 2014
|
|
- Amber Barker
- 5 years ago
- Views:
Transcription
1 Exam 2 Bio200: Cellular Biology Winter 2014 Name: Multiple Choice Questions Circle the one best answer for each of the following questions. (2 points each) 1. Which type of DNA repair includes the formation of an apurinic or apyrimidinic (AP) site? A. Nucleotide excision repair B. Mismatch repair C. Proofreading D. Base excision repair E. Recombination 2. In a eukaryote, what protein synthesizes rrna molecules? A. RNA Polymerase I B. RNA Polymerase II C. RNA Polymerase III D. rrna Polymerase E. Poly(A) Polymerase 3. Aminoacyl trna synthetases build a covalent bond between A. 5 phosphate group of a trna and the carboxylic acid group of an amino acid. B. 3 hydroxyl group of a trna and the amino group of an amino acid. C. 5 phosphate group of a trna and the amino group of an amino acid. D. 2 hydroxyl group of a trna and the amino group of an amino acid. E. 3 hydroxyl group of a trna and the carboxylic acid group of an amino acid. 4. Which post-translational modification usually leads to the destruction of the modified protein? A. Acylation B. Glycosylation C. Polyubiquitination D. Acetylation E. Phosphorylation 5. DNA repair by homologous recombination does NOT require which step listed below? A. Ligation B. Digestion of one strand of DNA C. Strand invasion D. Reverse transcription E. DNA polymerization 6. Peptidyl transferase activity is found in which complex? A. Large subunit of the ribosome B. EF-Tu C. Nucleolus D. SRP E. EF-G Version A page 1 of 6 Feb. 19, 2014
2 7. Which type of DNA repair requires the assistance of a helicase? A. Nucleotide excision repair B. Proofreading C. Base excision repair D. Translesion synthesis E. require a helicase 8. Eukaryotes don t possess Shine-Dalgarno sequences. Instead, this job is performed by what structure or sequence? A. TFIID B. PolyA tail C. AAUAAA D. eif4f E. 5 cap 9. Which protein escorts a charged trna into the A site of the ribosome? A. eif4f B. EF-G C. RF D. EF-Tu E. 10. Which polymerase does not require a template? A. Poly(A) polymerase B. Primase C. Telomerase D. Reverse transcriptase E.. All polymerases require a template. 11. The diagram on the right illustrates the orientation of the PGE1 protein immediately after translation on the rough. On the diagram below, show the location and names of all required targeting signals that are needed for the correct synthesis of PGE1. (4 points) N- -C Start Stop Start Transfer Transfer Transfer Sequence Sequence Sequence Version A page 2 of 6 Feb. 19, 2014
3 12. There are six codons for Serine (Ser) in the genetic code. What is the minimum number of trna Ser molecules that must be synthesized for accurate translation? (1 point) 3 List the anticodon sequence for each trna Ser that you identified above. (4 points) 5 GCU 3, 5 IGA 3, 5 CGA 3 OR 5 GCU 3, 5 GGA 3, 5 UGA 3 Wobble Rules Anticodon Base Codon Base C G A U U A or G G C or U I U, C or A 13A. The nontemplate strand of the very tiny Drosophila gene Liliputian is shown below with start and stop codons underlined. We wish to tag the Liliputian protein with the epitope Cys-Cys-Tyr. Modify the sequence below so that it is appropriately epitope tagged. (3 points) 5 TGAGCATCGGTATGGCACCCTTAATGGGCATTGCACCCATAGTACGATAAGCATGTCCTGAAACTAGT3 insert TGTTGCTAC 13B. What is one reason that we might want to epitope tag this gene? (2 points) IF (or western blot) Version A page 3 of 6 Feb. 19, 2014
4 14A. Electrophoresis separates molecules on the basis of what three characteristics? (1 point each) Size Charge Shape 14B. Describe one key change that is necessary for protein electrophoresis compared to DNA electrophoresis. Briefly explain why that change is needed. (3 points) Any one of: Samples are boiled to be denatured. DTT is added to break disulfide bonds SDS is added to even out the charge density 15. RT-PCR is a commonly used technique to analyze mrna from biological samples. 15A. Name the two enzymes required for RT-PCR. (4 points) Reverse Transcriptase and Taq DNA polymerase 15B. For this experiment, do I need to add: NTPs, dntps, both or neither? (1 point, circle one) 15C. If we are interested in the hexokinase gene, which reagent allows us to examine just the hexokinase gene and not all the other mrna in the sample? (2 points) Primers 16. For each statement below, name the replication protein that is described. (2 points each. Standard abbreviations are fine). This enzyme hydrolyzes ATP to provide the power to break apart hydrogen bonds. This protein is able to specifically recognize an origin of replication. This polymerase always synthesizes the same six-nucleotide sequence. This protein prevents single-stranded DNA from binding to its complementary strand. This protein binds to DNA polymerases and helps the enzyme stay associated with the DNA. This polymerase uses NTPs for substrates. Helicase ORC Telomerase SSB PCNA Primase Version A page 4 of 6 Feb. 19, 2014
5 17. Proofreading requires two different enzymatic activities. Name those two specific activities and name the protein that has each activity. (4 points) Activity: 5 3 Polymerase Protein: DNA Polymerase Activity: 3 5 Nuclease Protein: DNA Polymerase 18. After getting interested in -synuclein, we decide to look at Parkin, another protein involved with Parkinson disease. For each of the following questions, name one technique that we could use to answer the question. (2 points each; standard abbreviations are acceptable) Question: Do the levels of the Parkin protein increase in cells from older patients? How abundant are each of the four spliced forms of Parkin mrna in adult neurons? Is the Parkin protein located at the plasma membrane of a Parkinson disease patient s cells? If we inhibit the Parkin protein with a specific drug, how does that change which other genes are being transcribed? Technique: Western blot Northern blot IF Microarray 19. During splicing, introns are removed from the newly made RNA. 19A. In what subcellular location does this process happen? (1 point) 19B. What is the group of proteins that catalyze reactions? snrnps (1 point) 19C. Before splicing, the newly made RNA is called the primary transcript (2 points) 19D. During this process, an RNA end with a free 5 phosphate is never present. Describe how the intron can be removed without a free 5 end being generated. (2 points) The 5 phosphate is immediately connected to a 2 hydroxyl at the branchpoint to make the lariat structure. Thus, the 5 phosphate is never free. 19E. The disposal of introns seems wasteful. Briefly describe one reason why introns can be considered advantageous. (2 points) Alternative splicing allows a single gene to encode several distinctly different proteins. Version A page 5 of 6 Feb. 19, 2014
6 20. In a eukaryotic cell, proteins can be specifically targeted to each of four subcellular locations. For each statement below, transport to which location or locations is being described? Circle all that apply. (2 points each) The protein is transported in its native structure. The correct localization of this protein required a chaperone. All targeting sequences were removed in the mature protein. The correct localization of this protein required SRP. Release Factor s activity was required before transport began. This protein was translated on a ribosome that was part of the rough. 21A. On the fully functional promoter shown below, draw a bent arrow ( ) to show the approximate site at which transcription will begin and the direction that it will go. (2 points) 21B. Which strand is the sense strand? (1 point; circle one) top strand bottom strand not enough information to know 22. HDACs are proteins that alter the post-translational modifications of other proteins to affect transcription. 22A. What post-translational modification do HDACs affect? acetylation (2 points) 22B. Do HDACs add or remove this modification? remove (1 point) 22C. What substrate protein is being modified? histone (2 points) 22D. Does this modification activate or repress transcription? repress (1 point) Version A page 6 of 6 Feb. 19, 2014