Activin B induces noncanonical SMAD1/5/8 signaling via BMP type I receptors in hepatocytes:

Transcription

1 1 SUPPLEMENTAL INFORMATION Activin B induces noncanonical SMAD1/5/8 signaling via BMP type I receptors in hepatocytes: evidence for a role in hepcidin induction by inflammation in male mice Susanna Canali, Amanda B. Core, Kimberly B. Zumbrennen-Bullough, Maria Merkulova, Chia- Yu Wang, Alan Schneyer, Antonello Pietrangelo, and Jodie L. Babitt

2 2 Supplemental Table 1: Antibody Table Peptide/protein target Name of Antibody Manufacturer, catalog # Species raised in; monoclonal or polyclonal Dilution used Activin B Human Activin B beta subunit R & D Systems #MAB659 Mouse, monoclonal 1:500 Human/mouse HJV Human/Mouse RGM C/ R & D Systems #AF3720 Goat, polyclonal 1:200 Hemojuvelin Pan actin Anti-Actin, clone C4 Millipore, #MAB1501 Mouse, monoclonal 1: Mouse Hjv Mouse Rgm-c R & D Systems #AF3634 Goat, polyclonal 1:200 P-STAT3 phospho-stat3 (Ser727) Cell signaling #9134 Rabbit, polyclonal 1:1000 P-SMAD1/5/8 Phospho-Smad1 (Ser463/465)/ Cell Signaling #9511S* Rabbit, polyclonal 1:1000 Smad5 (Ser463/465)/ Smad9 *Now discontinued P-SMAD2 Phospho-Smad2 (Ser465/467) Antibody (Ser465/467) #9511 Cell Signaling #3101S Rabbit, polyclonal 1:1000 P-SMAD3 Phospho-Smad3 (Ser423/425) Cell signaling #9520 Rabbit, monoclonal 1:1000 STAT3 Stat3 Cell signaling #9132 Rabbit, polyclonal 1:1000 SMAD1 Smad1 Cell signaling #9743 Rabbit, polyclonal 1:1000 SMAD2 Smad2 (D43B4) XP Rabbit Cell signaling #5339 Rabbit, monoclonal 1:2000 mab SMAD3 Smad 3 Cell signaling #9513 Rabbit, polyclonal 1:1000 Goat IgG Donkey anti-goat IgG HRP Jackson ImmunoResearch Donkey 1:5000 # Rabitt IgG Anti-rabitt IgG, HRP-linked Cell Signaling #70745 Goat 1:2000 antibody Mouse IgG Peroxidase-conjugated Affinipure Goat Anti-mouse IgG Fcγ Subclass I specific Jackson ImmunoResearch # Goat 1:3000 Hemagglutinin (HA) HA probe (Y-11) Santa Cru Biotechnology sc-805 Rabbit, polyclonal 1:1000 c-myc Anti-c-Myc Abcam, ab19234 Goat, polyclonal 1:1000 P-SMAD5 Anti-SMAD5 (phospho S463 + S465) antibody Abcam, ab92698 Rabbit, monoclonal 1:1000 SMAD5 Anti-SMAD5 antibody [EP619Y] Abcam, ab40771 Rabbit, monoclonal 1:2000

3 3 Supplemental Table 2. Sequences of primers used in qrt-pcr reactions (m mouse, h human) Primers Forward Reverse mhamp ttgcgataccaatgcagaaga gatgtggctctaggctatgtt mid1 ttggtctgtcggagcaaagcgt cagccgttcatgtcgtagagca mrpl19 aggcatatgggcatagggaagag ttgaccttcaggtacaggtgtg mil6 ctctgcaagagacttccatcca cgtggttgtcaccagcatca minhbb tcagctttgcagagacag gaagaagtacaggcggac mhjv cacggcagccctccaacttaa gacatactcggcattgcagcgg mdmt1 tgtttgattgcattgggtctg cgctcagcaggactttcgag mfpn ttgcaggagtcattgctgcta tggagttctgcacaccattgat hhamp cacaacagacgggacaac cgcagcagaaaatgcaga hid1 gggattccactcgtgtgttt ctgagaagcaccaaacgtga hrpl19 tccgctgtggcaagaagaaggt accgtcacaggcttgcggat halk2 tgccaaggggactggtgtaa actgcgaacactacagagagaa halk3 tgaaatcagactccgaccaga tggcaaagcaatgtccattagtt halk4 caggatcgacttgagggtgc ctggtaggcatcatcgccg halk6 accagacctcgatacagcatt cccatagcgaccttttccaat halk7 acttgtgccatagcggactta ggttcccactttaggattctgag hacvr2a atcacaagatggcctaccctc ccaggcaaactgtagacttcgta hacvr2b tgaagcacgagaacctgctac cttgaggtaatccgtgaggga hbmpr2 cactcagtccacctcattcattt ttgtttacggtctcctgtcaac hhjv acccggaagctcaccatcat acatggttcccagggttagca hsmad5 tctccaaacagcccttatccc gcaggaggaggcgtatcag hsmad3 gcgtgcggctctactacatc gcacattcgggtcaactggta hsmad2 aacaggacgattagatgagc gacctggtttgttcagagaagc

4 4 Su1 sictrl sismad5 CTRL BMP6 CTRL BMP6 P-SMAD SMAD ACTIN 49] 38 ~ ~

5 5 Supplemental Figure 1. Validation of Abcam P-SMAD5 and SMAD5 antibodies. Hep3B cells were transfected with Control sirna (sictrl) or sismad5 (40 nm). Twenty-four hours after transfection, cells were serum starved in 1% FBS for 24 hours, followed by incubation in the absence or presence of 5 ng/ml BMP6 for 3 hours. Cell lysates were analyed by immunoblot with P-SMAD5 antibody (Abcam Ab 92698, see Table S1). Blots were stripped and re-probed with SMAD5 antibody (Abcam Ab40771, see Table S1), followed by actin antibody. The P-SMAD5 and SMAD5 antibodies each recognied major bands at the appropriate molecular weight. P-SMAD5 bands were strongly induced by BMP6. SMAD5 and BMP6- induced P-SMAD5 bands were potently inhibited by sismad5.

6 6 S2 A <( (( 1. Em 0> 0) c 1.,._ ~. it-5 ~-oo l('j 0. QLL ~-- ~ 0. (/) CTRL *** SMAD5 SMAD3 SMAD2 B ACTIN sictrl sis MADS c <( (( 1. Em 0> 0) c 1.,._ ~. it-5 ~-oo ~ 0. QLL ~-- ~ 0. (/) CTRL SMAD5 SMAD3 SMAD2 D ACTIN sictrl sismad3-1 l E <( a: 1. Em 0)0>.,._ c 1 -J~. a..-5 ~-oo C\lo. QLL ~.._. 0. (/) CTRL SMAD5 SMAD3 SMAD2 F ACTIN sictrl sismad2

7 7 Supplemental Figure 2. Specificity and efficacy of sirnas targeting SMAD5, SMAD3, and SMAD2 in Hep3B cells. Hep3B cells were transfected with control sirna, sismad5, sismad3, or sismad2 (40 nm). Forty-eight hours after transfection, SMAD relative to RPLI9 mrna levels were measured by qrt-pcr (A, C, E) and SMAD relative to Actin protein levels were measured by immunoblot (B, D, F). For A, C, E, results are reported as the mean ± SEM from 3 separate experiments performed in triplicate for the fold-change relative to sictrl, which was normalied to 1. Statistical significance was determined by one-way ANOVA with Dunnett s post-hoc test for multiple pairwise comparisons (*** P < relative to CTRL). sismad5, sismad3, and sismad2 each potently and specifically inhibited their respective mrnas and proteins.

8 Supplementary Figure 83 8 A Hep3B ALK4 ALK7 ALK2 ALK3 ALK6 B <t: a:- E ~ O)c:1,_ C'Cl..,J.s::: 0.. (..) ~ ~ 0. ~~..,J ~ c <{ a:- Q) E Ol 1 0) c:,_ C'Cl..,J.s::: 0.. (..) ~~ 1-...:u._ ~--..,J ~ sirna D E <( a:- E ~ 0) c: 1,._ C'Cl -J..c a.. (..) ~~ Q!:S -J '<:( sian A F <( 1. a:- E ~ 0) ffi 1.,_..c O:u 0::: "0 0. ~0 ~!:S ~ 0. sian A G 18: HA I 18: Actin I sictrl sictrl sialk4 ALK4-HA ALK4-HA kda ~:: H 18: Myc I 18: Actin j sictrl sictrl sialk7 ALK7 -Myc ALK7 -Myc kda l::

9 9 Supplemental Figure 3. Specificity and efficacy of sirnas targeting Activin and BMP type I receptor expression in Hep3B cells. A) RT-PCR of Activin (ALK4 and ALK7) and BMP type I receptors (ALK2, ALK3, and ALK6) in Hep3B cells. B-F) Hep3B cells were transfected with control sirna or sirna targeting the Activin or BMP type I receptors (40 nm). Forty-eight hours after transfection, type I receptor relative to RPLI9 mrna levels were measured by qrt- PCR. Results are reported and analyed as in Figure S2. G-H) A human ALK4 cdna clone was purchased from GE Healthcare Dharmacon (cat no MHS ). Platinum Pfx DNA Polymerase (Invitrogen) was used to amplify bp ALK4 using gene specific primers containing BamH1 and Xho1 restriction sites (forward 5 - AAAGGATCCATGGCGGAGTCGGCCGGAGCCTCCTCC-3 ; reverse 5 - AAACTCGAGGATCTTCACGTCTTCCTGCACGC-3. The fragment was ligated into pcdna3 upstream of an HA-tag using BamH1 and Xho1 restriction sites. The ALK4-HA construct was confirmed by sequencing. Plasmid containing myc-tagged human ALK7 cdna (ALK7-Myc) was a gift from Dr. Daniel Bernard (McGill). Hep3B cells were transfected with control sirna (CTRL), sialk4, or sialk7 (40nM) in combination with empty vector, ALK4-HA, or ALK7-Myc. Forty eight hours after transfection, cell lysates were analyed by immunoblot with HA antibody or Myc antibody. Blots were stripped and re-probed with Actin antibody as a loading control. sialk4, sialk7, sialk2, sialk3, and sialk6 each potently and specifically inhibited their respective mrnas. sialk4 and si-alk7 inhibited protein expression of the ALK4-HA and ALK7- Myc constructs respectively. We have previously demonstrated that sialk2, sialk3, and sialk6 inhibit expression of their respective proteins (Xia et al. Blood. 2008;111(10): ).

10 10 Supplementary Figure 84 A HEP3B 1-1 BMPR2 ACVR2A ACVR2B HJV c CTRL BMPR2 ACVR2A ACVR2B CTRL BMPR2 ACVR2A ACVR2B D <( a: E Q) 1.s O)Ol,_ c -.J co 1.0 Q...C ~~ co 0 &!!:!:- ~ ~ CTRL BMPR2 ACVR2A ACVR2B E <( _ a: Q) E g> 1 0) co,_..c -.J () a.. -o 0 ~ 0 ::::;:u. """)- :r:

11 11 Supplemental Figure 4. Specificity and efficacy of sirnas targeting Activin/BMP type II receptors and HJV in Hep3B cells. A) RT-PCR of Activin/BMP type II receptors (BMPR2, ACVR2A, ACVR2B) and the co-receptor HJV in Hep3B cells. B-E) Hep3B cells were transfected with control sirna or sirna targeting Activin/BMP type II receptors or HJV (40 nm). Forty-eight hours after transfection, type II receptor or HJV relative to RPLI9 mrna levels were measured by qrt-pcr. Results are reported and analyed as in Figure S2. siacvr2a, siacvr2b, sibmpr2, and sihjv each potently and specifically inhibited their respective mrnas. We have previously shown that these sirnas inhibit BMPR2, ACVR2A, and ACVR2B protein expression (Xia et al. Blood. 2008;111(10):

12 12 Supplementary Figure S5 7 BMP6 <( 6 a: Q) 5 E g> 0),_..c co 4...J () Q-o3 ~ 0.,_ u.. 2 Q 1 *** ACTS *

13 13 Supplemental Figure 5 Activin B signals via SMAD5, but not SMAD2/3, to induce ID 1 mrna in Hep3B cells. Hep3B cells transfected with control sirna (CTRL), sismad5, sismad3, or sismad2 (40 nm) and incubated in the absence or presence of 5 ng/ml Activin B or BMP6 from Figure 4 were analyed for ID1 relative to RPL19 mrna levels by qrt-pcr. Data are expressed and analyed as described in Figure 4.

14 14 Supplementary Figure S6 A <( a: Q) E g' 0)~,_..c...J (.) a..-o ~ 0,_u. Q 7 ACTB *** I BMP6 * I B 7 BMP6 <( 6 a: Q) 5 E g' 0) ~,_..c 4...J (.) 3 a..-o ~ 0,_ u. 2 Q 1... ACTB

15 15 Supplemental Figure 6. Activin B signals via BMP type I receptors ALK2 and ALK3 to induce ID1 mrna in Hep3B cells. A-B) Hep3B cells transfected with 40 nm control sirna (CTRL) or sirna targeting Activin (ALK4, ALK7) or BMP type I receptors (ALK2, ALK3, ALK6), and incubated in the absence or presence of 5 ng/ml Activin B or BMP6 from Figure 5 were analyed for ID1 relative to RPL19 mrna levels by qrt-pcr. Data are expressed and analyed as described in Figure 5.

16 16 Supplementary Figure 87 BMP6 <( a: Q) El? O)«l.,._.s::. -.1 (.) Q..-o ~ 0.,._u. Q ACTS... I T sirna

17 17 Supplemental Figure 7. Activin B signals via the type II receptor ACVR2A to induce ID 1 mrna in Hep3B cells. A-B) Hep3B cells transfected with 40 nm control sirna (CTRL) or sirna targeting Activin or BMP type II receptors (BMPR2, ACVR2A, ACVR2B), and incubated in the absence or presence of 5 ng/ml Activin B or BMP6 from Figure 6 were analyed for ID1 relative to RPL19 mrna levels by qrt-pcr. Data are expressed and analyed as described in Figure 6.

18 Supplementary Figure S8 18 A HEP3B - KGN -Ill > Ill > """") ~ (!J I a: a: """") ~ (!J I C2C12 IMCD <( Ill > <( Ill > """") ~ ~ (!J (!J I (!J (!J I ~ ~ """") a: a: a: a: 8 HEP3B KGN D IMCD CTRL BMP6 ACTA ACTB c P-SMAD2 CTRL BMP6 ACTA ACTB ** ** CTRL BMP6 ACTA ACTB

19 19 Supplemental Figure 8. Expression of repulsive guidance molecule family members and responsiveness to Activins in Hep3B, KGN, IMCD, and C2C12 cells. A) HJV and repulsive guidance molecule family member RGMA and RGMB mrna expression was evaluated by RT-PCR in Hep3B, KGN, IMCD, and C2C12 cells. B) Hep3B, KGN, and IMCD cells were transfected with CAGA-Luc and prl-tk. Forty-eight h after transfection, cells treated in the absence or presence of 5 ng/ml BMP6, Activin B, or Activin A for 6 h followed by measurement of relative luciferase activity. C) C2C12 cells stably transfected with BRE-Luc were treated in the absence or presence of 5 ng/ml BMP6, Activin B, or Activin A for 6 h followed by measurement of P-SMAD2 relative to total SMAD2 and Actin protein by immunoblot and chemiluminescence quantitation. A representative immunoblot is shown. B-C) Results are expressed as mean +/- SEM from 2 or 3 separate experiments each performed in triplicate. For B, results are reported as the fold change relative to the respective untreated CTRLs, which were normalied to 1. Statistical significance was determined by one-way ANOVA with Dunnett s post-hoc test for pairwise multiple comparisons (* P <.05, ** P <.01, *** P <.001 compared with CTRL).

20 20 Supplementary Figure S9 A LPS B c Turpentine..-.. BA ;::?_ ;::?_ ;::?_ (1j (1j "E en en en I-- I-- I-- E E E :::J... :::J... :::J... Q) Q) Q) (J) (J) (J) D E F <( <( Turpentine <( a:~ a:~ a:~ E 1 E c E c O)_c 0)~ 0) ~ 1.!:: (.)!:: (.)!:: (.) ~~0 ~~ ~~ ' LL 0. ' LL ' LL :t'-o :t'- :t' H 24H G H <( <(_ Turpentine Q) Q) ~ Q) 1 0:0> 0:0> a:~ E E E: ~ 1 O).C O).C.,.._ (.).,.._ (.) ~- --o --o Q~ ~0 ~0 <l LL Cc5~ ~~ SQ~ -- :::::: - - 6H 110 6H 110 6H 110 J PBS LPS K PBS L PBS BA P-Stat31 Stat3 M PBS LPS

21 21 Supplemental Figure 9. Lipopolysaccharide (LPS), Turpentine, and heat-killed Brucella abortus (BA) induce inflammation and hypoferremia in mice with variable effects on Hjv mrna expression. 8 week-old C57BL/6 male mice treated with PBS or LPS (A, D, G, J, M), PBS or Turpentine (B, E, H, K, N), or PBS or BA (C, F, I, L, O) for the indicated times from Figure 8 were analyed for serum transferrin saturation (A-C), Hjv (D-F) or Il6 relative to Rpl19 mrna (G-I) by qrt-pcr, or P-Stat3 (J-L) or P-Smad5 (M-O) relative to total Stat3 or Smad5 by immunoblot. (A-C) Results are reported as mean ± SEM. (D-I) Results are reported as mean ± SEM for the fold change relative to the PBS group, which was normalied to 1. (J-O) Representative immunoblots are shown. Statistical significance was determined by Student s t- test (C, F, I) or one-way ANOVA with Dunnett s post-hoc test for pairwise multiple comparisons with * P <.05; ** P <.01; *** P <.001 relative to the control (PBS) group.