Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1

Transcription

1 Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 a His-ORMDL3 ~ 17 His-ORMDL3 GST-ORMDL IPTG GST-ORMDL3 ~ b Integrated Density (ORMDL3/ -actin) PBS * Alternaria ORMDL3 17 M1 M2 PBS Alternaria Validation of ORMDL3 antibody and expression of ORMDL3 in lung tissue of Alternaria-challenged mice. (a) Western blot analysis of bacterial lysates expressing His-tagged recombinant human ORMDL3 or GST-tagged recombinant murine ORMDL3 (fusion protein) with polyclonal ORMDL3 antibodies against a synthetic peptide corresponding to internal sequence amino acids of human ORMDL3. (b) Expression of ORMDL3 in the lungs of C57BL/6 mice challenged with Alternaria alternata or PBS (n=4 mice/group) by Western blot analysis with anti-ormdl3 followed by densitometry using ImageJ. Data represents mean ± SEM.*p<0.02 compared to PBS-exposed mice. Statistical significance was determined by unpaired two-tailed Student s t-test. ORMDL3 expression in lung tissue from representative PBS or Alternaria-challenged mice (M1, M2) is shown below graph.

2 Supplementary Fig. S2 a Control Allergen-challenged OVA b No. of cells x PBS Alternaria CRA 0 Eos Mono Neu Lymphs Expression of ORMDL3 in allergen-challenged lungs and Alternaria-induced eosinophilia. (a) Expression of ORMDL3 in the lungs of C57BL/6 mice exposed to chronic ovalbumin (OVA) challenge (upper right panel), acute cockroach antigen (CRA) challenge (lower right panel) or saline alone (Control, upper and lower left panels) by immunohistochemistry. Scale bar represents 10 μm. Data is representative of 2-3 mice/group. (b) Differential cell counts in BALF of C57BL/6 mice challenged with Alternaria alternata or PBS as control (n=4 mice/group). Eos: Eosinophils; Mono: Monocytes/macrophages; Neu: Neutrophils; Lymphs:Lymphocytes. Data represents mean ± SEM.

3 Supplementary Fig. S3 a No. of rolling cells/min PBS VCAM-1 * * * Control b Control- GFP GFP α4, 204 bp β2, 98 bp β-actin, 160 bp c Control αm, 209 bp αl, 202 bp β1, 100 bp β-actin, 160 bp Knock-down of ORMDL3 does not alter eosinophil rolling or expression of αm, αl and β1 integrins. (a) Rolling of BM-derived eosinophils transfected with or Control- on recombinant murine VCAM-1-coated cover-slips under conditions of flow in vitro. Combined data (mean ± SEM) of three experiments in duplicate is shown. *p < 0.01 compared to rolling on PBS. Statistical significance was determined by unpaired two-tailed Student s t-test. (b) Expression of α4 and β2 integrins in eosinophils over-expressing ORMDL3 after transfection with GFP by RT-PCR. (c) Expression of αm, αl and β1 integrins in eosinophils transfected with or Control- by RT-PCR. Expression of β-actin is shown as the internal control in b and c. Data shown is representative of three independent experiments.

4 Supplementary Fig. S4 a [Ca 2+ ] i nm Basal Eot-1 p > 0.05 b % Chemotaxis d Control- Rat IgG Control- Anti-CCR3 Rat IgG Anti- CCR3 0 Control- c 0 (-) IL-3 Control- GFP (+) IL-3 GFP CD48 β-actin Increased migration of eosinophils over-expressing ORMDL3 and induction of CD48 expression in BM-derived eosinophils by IL-3. (a) Basal and agonist (eotaxin-1 [Eot-1], 100 nm)-induced intracellular Ca 2+ levels in untreated versus Control-treated BM-derived eosinophils. Combined data for 145 untreated cells and 598 Control--treated cells is shown. (b) Chemotaxis of untreated, GFP-treated or Control-GFP treated BM-derived eosinophils in response to eotaxin-1 (100 nm) in vitro. Combined data (mean ± SEM) of three experiments in duplicate is shown. Statistical significance in (a) and (b) was determined by unpaired two-tailed Student s t-test. (c) Eosinophils were cultured in medium alone or medium containing IL-3 (100 ng/ml) for 12 h at 37ºC and expression of CD48 in cell lysates was evaluated by Western blot. Expression of β-actin is shown as the internal control. Data is representative of two independent experiments with BM-derived eosinophils from different mice. (d) Expression of CCR3 in ORMDL-3-silenced BM-derived eosinophils by flow cytometry using FITC-conjugated rat anti-mouse CCR3 antibodies at 5μg/ml. Representative data of three independent experiments with BM eosinophils from different mice is shown.

5 Images of full immunoblots used in the main figures: Supplementary Fig. S5 Fig. 2b (lower panel) Fig. 2c (upper panel ) Fig. 2c (lower panel) ORMDL3 17 ERK 1/2 44/42 p-erk 1/2 44/42 p p-p Control IL-3 Control-GFP GFP Control-GFP GFP Control-GFP GFP Control-GFP GFP Fig. 3a (left lower panel) Fig. 4e (middle panel) ORMDL3 17 -actin CD actin -10 Control Control Control Control

6 Supplementary Fig. S6 Images of full immunoblots used in supplementary figures: Fig. S4c CD actin Control IL-3 Control IL-3

7 Supplementary Tables Supplementary Table S1 Primer sequences for RT-PCR Gene ORMDL3 CD18 ( β2) CD49d (α4) CD29 (β1) CD48 CD11a (αl) CD11b ( αm) β-actin Forward Primer CACACGGGTGATGAACAGTC CAGGAATGCACCAAGTACAAAGT CCCAGGCTACATCGTTTTGT TTCAGACTTCCGCATTGGCTTTGG CCTGGTCCAGTGAAGTTCAGC ATGCACCAAGTACAAAGTCAGC TTCAGACTTCCGCATTGGCTTTGG GGTCATCACTATTGGCAACG Reverse Primer TTTGCCTTGGTCTGGAGTCT CCTGGTCCAGTGAAGTTCAGC CATGAATGGGGGTAAGGATG TGGGCTGGTGCAGTTTTGTTCAC CCAAGTATAGTCAACATGCTGGT TTGGTCGAACTCAGGATTAGC TGGGCTGGTGCAGTTTTGTTCAC ACGGATGTCAACGTCACACT

8 Supplementary Table S2 Effect of ORMDL3 silencing on eosinophil viability and proliferation Treatment Cell viability (% Mean ± SEM)* Before transfection After transfection ± ± 1.85 Fold increase in cell number after transfection* 1.72 ± 0.37 Control ± ± ± ± ± ± 0.38 *Combined data of eleven independent murine eosinophil transfections is shown.

9 Supplementary Methods Murine eosinophils BM cells collected from the femurs of mice were cultured in RPMI 1640 supplemented with 20% FBS, 2 mm glutamine, 25 mm HEPES, nonessential amino acids, 1mM sodium pyruvate and 50 μm 2-ME (all reagents from Invitrogen). Stem cell factor and FLT3 ligand (PeproTech) were added to the medium at 80 ng/ml during initial culture. On day 4, cells were transferred to medium containing 10 ng/ml rm IL-5 (PeproTech) and sub-cultured every other day up to day 14, maintaining starting cell density at 10 6 /ml each time. Western Blot Analysis Eosinophils were lysed with a 1:1 mixture of 2 gel loading buffer and RIPA buffer. In ORMDL3 silencing studies, equal number of Control-- or -treated eosinophils were used to prepare lysates. For ORMDL3 expression, samples were electrophoresed on 20% SDS polyacrylamide gels and membranes were blocked with Odyssey Blocking Buffer (LI-COR Biosciences) for 36 h at 4ºC after transfer. Rabbit polyclonal antibodies against ORMDL3 pre-absorbed against eosinophil lysates on PVDF membranes were used as the primary antibody with IRDye 800CW conjugated goat anti-rabbit IgG (1:7000, LI-COR Biosciences) for detection. Both antibodies were diluted in Odyssey Blocking Buffer containing 0.1% Tween 20, 0.02% SDS and 0.5% BSA as additional blocking agents to prevent non-specific binding. For p38, phospho-p38 and CD48 expression, 10 or 12% SDS polyacrylamide gels were used with IRDye 800CW conjugated goat anti-rabbit IgG or IRDye 680 conjugated goat anti-mouse IgG for detection (1:5000, LI-COR Biosciences). Protein bands were detected using Odyssey Infrared Imaging system (LI-COR Biosciences). For ERK (1/2) and phospho-erk (1/2), anti-rabbit IgG (1:5000, Cell Signaling Technology) followed by Immobilon Western Chemiluminescent HRP Substrate (Millipore) was used to detect bound primary antibodies and protein bands were visualized on X-ray films. In all cases, cell lysates were first standardized for loading volume based on uniform expression of β-actin by Western blot analysis followed by densitometry before final analysis. For quantitation, scanned images were analyzed using ImageJ and density of the ORMDL3 band was normalized against β-actin after background subtraction.

10 Measurement of intracellular calcium concentration Eosinophils attached to poly-l-lysine-coated (10 µg/ml) glass cover-slips were incubated with 5 μm Fura-2 AM for 30 min at 37 C and 5% CO2. Cover-slips were washed gently, perfused with HBSS containing 10 mm HEPES, 11 mm glucose, 2.5 mm CaCl 2, and 1.2 mm MgCl 2 (ph 7.4) and mounted on the stage of a Nikon Diaphot inverted microscope in an open slide chamber. Fura-2 AM-loaded cells were alternately excited at 340 and 380 nm with a Lambda DG-4 high-speed wavelength switcher (Sutter Instrument Co.). Fluorescence emissions were collected separately for each wavelength using a 510-nm barrier filter by real-time digital video fluorescence imaging using NIS-Elements imaging software (Nikon Instruments Inc.) at the rate of one image for every 0.75 s and ratios of fluorescence intensities at 340 nm and 380 nm were determined at each time point from which [Ca 2+ ] i was calculated from the ratio of intensities at 340 and 380 nm using a calibration curve. After measuring basal [Ca 2+ ] i in eosinophils perfused with HBSS for 1 min, cells were perfused with HBSS containing 100 nm eotaxin-1 (Peprotech) and evaluated for an additional 4 min to assess agonistinduced [Ca 2+ ] i responses. 2 μm 4-Bromo-calcium ionophore was used as a positive control.