Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.

Transcription

1 Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D ) sirna1: GAACCGACAUGCUCCCGGA sirna2: GCAUUCGCAUCAACCACAA sirna3: GGUCAUAGAGCUACCGUAU sirna4: AGACAAAGGUUACUAAUUG sirna1: CUAGAAAUCUGUUGCUAUG sirna2: CAGCUACCCUUCCAUCAUA sirna1: UAAAGUGGCUGCUCAGAAU sirna2: GAGUUACAGUGUCUUAAUA sirna3: UGGAGUAAGUCGAGAAGUA sirna4: CACCUUAUAUCUCGAAGUU

2 Supplementary Table 2. PCR primers, reaction conditions and expected fragment size for the semiquantitative RT-PCR. Gene Name Primer Sequence (5 to 3 ) B-cell translocation gene 2 (BTG2) Beta Actin ( -Actin) Breast cancer susceptibility gene 1 (BRCA1) Catalase Superoxide dismutase 1 (SOD1) Superoxide dismutase 2 (SOD2) F: AAGATGGACCCCATCATCAG R: AGCACTTGGTTCTTGCAGGT F: GGACTTCGAGCAAGAGATGG R:AGCACTGTGTTGGCGTACAG F:GGTGGTACATGCACAGTTGC R:TGACTCTGGGGCTCTGTCTT F: GCCTGGGACCCAATTATCTT R: GAATCTCCGCACTTCTCCAG F: AGGGCATCATCAATTTCGAG R: ACATTGCCCAAGTCTCCAAC PCR Product Size (bp) Number of Cycles F: TTGGCCAAGGGAGAT GTTAC R: AGTCACGTTTGATGGCTTCC PCR Reaction Conditions 95 o C 5 min 95 o C 0.5 min 52 o C 0.5 min 72 o C 1 min 72 o C 10 min 95 o C 5 min 95 o C o C o C 1 72 o C o C 5 min 95 o C o C o C 1 72 o C o C 5 min 95 o C o C o C 1 72 o C o C 5 min 95 o C o C o C 1 72 o C 1 95 o C 5 min 95 o C o C o C 1 72 o C 10

3 LEGENDS FOR SUPPLEMENTARY FIGURES Supplementary Fig. 1. BTG2 protects various cell types against oxidative stress. A. Subconfluent proliferating T47D cells were transfected overnight with wtbtg2 or empty pcdna3 vector; harvested using trypsin; seeded into 96-well dishes; allowed to attach; exposed to different concentrations of H 2 O 2 for 24 hr; and assayed for cell viability using MTT assays. B,C. MCF-7 cells were transfected with wtbtg2 or empty pcdna3 vector; harvested using trypsin; seeded into 96-well dishes; allowed to attach; exposed to different concentrations of paraquat (B) or nickel acetate (C) for 24 hr; and assayed for cell viability using MTT assays. D. MCF-10A cells were transfected overnight with wtbtg2 or empty pcdna3 vector and assayed for sensitivity to H 2 O 2 as described above. E. MCF-10A cells were pre-treated with BTG2-siRNA or control (CON)-siRNA for 48 hr and then assayed for sensitivity to H 2 O 2 as described above. Values plotted are means ± SEMs of three experiments. *P<0.05 for comparison with empty vector/control-sirna transfected cells. Supplementary Fig. 2. BTG2-mediated protection against oxidative stress is BRCA1-independent. A. T47D cells were transfected with the indicated combination of sirna plus expression vector and then tested for sensitivity to H 2 O 2 using MTT assays, as described above. B. HCC1937 cells were transfected with wtbtg2 or empty pcdna3 vector and then tested for sensitivity to H 2 O 2. C. T47D cells were co-transfected with the indicated combination of expression vectors and then assayed for sensitivity to H 2 O 2. Cell viability values are means ± SEMs of three independent experiments. *Represents statistically significant differences relative to empty vector/control sirna transfected cells (P < 0.05, two-tailed t-tests).

4 Supplementary Fig. 3. Western blots confirming the efficacy of cell transfections and sirna treatments. MCF-7, T47D, or MCF-10A cells were transfected with the indicated expression vector or treated with the indicated sirna and harvested for Western blotting to detect BTG2, BRCA1, NFE2L2, or β-actin (control for loading and transfer). Supplementary Fig. 4. Dependence of wtbtg2-induced antioxidant gene expression changes on NFE2L2. MCF-7 cells were co-transfected overnight with the indicated expression vectors; post-incubated for 24 hr to allow gene expression; and harvested for Western blotting. Panel A shows a representative Western blot. β-actin was used as a loading control. Panel B shows densitometric quantification of protein bands. Values are normalized to β-actin and expressed as fold-changes relative to the control value as means ± SEMs of three independent experiments. *P < 0.05 relative to empty vectortransfected cells. Supplementary Fig. 5. Densitometric quantification of RT-PCR and Western blot assays from Fig. 2. Panels A and B show quantification of RT-PCR (A) and Western blots (B) of MCF-7 cells transfected with wtbtg2 vs empty pcdna3 vector. Panels C and D show quantification of RT-PCR (C) and Western blots (D) of 184A1 cells treated with BTG2-siRNA or control (CON)-siRNA. Panel E shows quantification of Western blots for MCF-7 cells transfected with control (CON)-siRNA+pcDNA3, wtbtg2+consirna, NFE2L2-siRNA+pcDNA3, or NFE2L2-siRNA+wtBTG2. Values plotted are normalized to β-actin and expressed as fold-changes relative to the control value as means ± SEMs of three independent experiments. *Represents statistically significant differences relative to empty vector/control sirna transfected cells (P < 0.05).

5 Supplementary Fig. 6. BTG2 up-regulates antioxidant protein expression in T47D cells. A,B. T47D cells were transfected overnight with wtbtg2 or empty pcdna3 vector; post-incubated for 24 hr to allow gene expression; harvested; and subjected to semi-quantitative RT-PCR (A) or Western blot (B) analysis. Panels C and D show densitometric quantification of the RT-PCR (C) and Western blot (D) assays. Values are normalized to β-actin and expressed as fold-changes relative to control, as means ± SEMs of three independent experiments. *P < 0.05, as compared with empty vector control. Supplementary Fig. 7. BTG2 up-regulates antioxidant enzyme activity and attenuates oxidation of GSH in T47D cells. A-C. Subconfluent proliferating T47D cells were transfected overnight wtbtg2 or empty pcdna3 vector; post-incubated for 24 hr to allow gene expression; and assayed for catalase (A) or total superoxide dismutase (SOD) (B), and glutathione peroxidase (GPX) (C) activity. D. T47D cells were transfected with wtbtg2 or empty vector; exposed to different concentrations of H 2 O 2 for 24 hr; and assayed for reduced (GSH) and oxidized (GSSG) glutathione. In all panels, values plotted are means ± SEMs of three independent experiments. *Represents statistically significant differences (P < 0.05). Supplementary Fig. 8. BTG2 regulates NFE2L2/ARE signaling in T47D cells. Subconfluent proliferating T47D cells were co-transfected with NQO1-ARE-Luc reporter along with the indicated expression vector(s); post-incubated for 24 hr to allow gene expression; and harvested for luciferase assays. The total transfected DNA content was kept constant by addition of the empty pcdna3 vector. Luciferase values were expressed relative to cells transfected with NQO1-ARE-Luc reporter only, as means ± SEMs of three independent experiments. As a negative control, a control reporter plasmid (pgl3- Luc) was transfected. *Represents P < 0.05.

6 Supplementary Fig. 9. BRCA1 knockdown does not block wtbgt2-stimulated catalase and SOD activity. Subconfluent proliferating MCF-7 (A,B) or T47D (C,D) cells were treated with BRCA1-siRNA or control (CON)-siRNA; transfected with wtbtg2 or empty pcdna3 vector; post-incubated for 24 hr to allow gene expression; and assayed for catalase (A,C) or SOD (B,D) activity. Values plotted are means ± SEMs of three independent experiments. *P < Supplementary Fig. 10. BTG2 over-expression stimulates antioxidant protein expression in BRCA1-deficient HCC1937 human breast cancer cells. HCC1937 cells were transient transfected overnight with wtbtg2 or empty pcdna3 vector; postincubated for 24 hr to allow gene expression; and subjected to Western blotting to detect the indicated proteins. -Actin was utilized as a control for loading and transfer. Panel A shows a typical set of Western blots. Panel B shows densitometric quantification of Western blots from three independent experiments. Values plotted are normalized to β- actin and expressed as fold-changes relative to the control value as means ± SEMs. Panel C shows assays of catalase and SOD enzyme activity. Values are expressed as the foldchange relative to the vehicle control and plotted as means ± SEMs of three independent experiments. *P < Supplementary Fig. 11. NFE2L2 is required for basal and BTG2-stimulated antioxidant enzyme activity. MCF-7 cells were transfected with the indicated vector(s) and assayed for catalase (A) or SOD (B) enzymatic activity. The total transfected DNA content was kept constant by transfection of empty pcdna3 vector. Values are plotted as fold-changes relative to the vehicle-treated controls and are means ± SEMs of three independent experiments. *P < 0.05.

7 Supplementary Fig. 12. BTG2 associates with NFE2L2 in T47D cells. Subconfluent proliferating T47D cells were transfected with FLAG-BTG2 or empty pcmv6-flag vector (as indicated); post-incubated for 24 hr to allow gene expression; and subjected to anti-flag IP (A) or anti-nfe2l2 IP (B). Precipitated proteins were then Western blotted using anti-flag or anti-nfe2l2 antibody. As a negative control, IPs were performed using the appropriate non-immune IgG. The input lanes correspond to 10% of the protein utilized for IP. The data shown are representative of three independent experiments. Supplementary Fig. 13. BTG2 is physically present at the antioxidant response element (ARE) in T47D cells. A. Untransfected T47D cells were subjected to chromatin immunoprecipitation (ChIP) assays using anti-nfe2l2 antibody or non-immune rabbit IgG (negative control). The PCR primers correspond to: two different AREs (E1 and E2) of the heme oxygenase 1 (HO-1) gene, HO-1 exon 3 (negative control), an ARE (NQO1 pr) from the NADPH dehydrogenase quinone 1 gene, and NQO1 exon 2 (negative control). B. T47D cells were transfected with FLAG-BTG2 or empty pcmv6-flag vector (as indicated); and ChIP assays were performed using anti-flag or non immune mouse IgG (negative control). The data shown are representative of three independent experiments. Supplementary Fig. 14. Endogenous BTG2 is present at the AREs of NFE2L2- responsive genes in MCF-10A cells. A-C. Cells were exposed to H 2 O 2 (250 nmol/l) for the indicated times and subjected to ChIP assays using anti-nfe2l2 (B) or anti-btg2 (C) antibody or non-immune rabbit IgG (negative control). The PCR primers correspond to two different AREs (E1 and E2) of the HO-1 gene, HO-1 exon 3 (negative control), an ARE from

8 the NQO1 gene promoter (NQO1 pr), and NQO1 exon 2 (negative control). Panel A shows the input DNA. The data shown are representative of three independent experiments. Supplementary Fig. 15. Representative flow cytometry histograms for MCF-7 cells corresponding to Figs. 7B-7C. MCF-7 cells were transfected overnight with wtbtg2 or empty pcdna3 vector and treated without (A) or with (B) H 2 O 2 (500 nmol/l of H 2 O 2 ) for 24 hr. Cell nuclei were then stained with propidium iodide; and cell cycle analysis was performed by flow cytometry. Supplementary Fig. 16. Box B is required for BTG2-mediated stimulation of antioxidant protein expression in MCF-7 cells. Cells were transfected overnight with the empty pcmv vector, wt-ha-btg2, HA-BTG2 A, or HA-BTG2 B or HA-BTG2 C; post-incubated for 24 hr to allow gene expression; and Western blotted to detect BTG2, catalase, SOD1, SOD2, or β-actin (loading control). Panel A shows a representative Western blot. Panel B shows densitometric quantification of Western blots from panel A. Values plotted are normalized to β-actin and expressed as fold-changes relative to the control value as means ± SEMs of three independent experiments. *P < 0.05 relative to wt-ha-btg2.

9 Supplementary Fig. 1. Karve et al., 2011 A T47D B MCF-7 C MCF-7 D MCF-10A E MCF-10A

10 Supplementary Fig. 2. Karve et al., 2011 A T47D B HCC1937 C T47D

11 Supplementary Fig. 3. Karve et al., 2011 A B MCF-7 T47D C MCF-7 D T47D E MCF-10A F MCF-10A G MCF-7 H T47D I MCF-7

12 Supplementary Fig. 4. Karve et al., 2011 B MCF-7 A MCF-7

13 Supplementary Fig. 5. Karve et al., 2011 A MCF-7 B MCF-7 C 184A1 D 184A1 E MCF-7

14 Supplementary Fig. 6. Karve et al., 2011 C T47D D T47D

15 Supplementary Fig. 7. Karve et al., 2011

16 Supplementary Fig. 8. Karve et al., 2011 A T47D B T47D

17 Supplementary Fig. 9. Karve et al., 2011

18 Supplementary Fig. 10. Karve et al., 2011 B HCC1937 A HCC1937 C HCC1937 D HCC1937

19 Supplementary Fig. 11. Karve et al., 2011 A B

20 Supplementary Fig. 12. Karve et al., 2011

21 Supplementary Fig. 13. Karve et al., 2011

22 Supplementary Fig. 14. Karve et al., 2011 A B C MCF-10A MCF-10A MCF-10A

23 Supplementary Fig. 15. Karve et al., 2011 Count A MCF-7 pcdna3 G0/G1: 50% S: 37% G2/M: 13% Count wtbtg2 G0/G1: 65% S: 27% G2/M: 8% Count B MCF-7 DNA content pcdna3 + H 2 O 2 T=24 hr Pre-G1: 14% G0/G1: 47% S: 41% G2/M: 12% Count DNA content wtbtg2 + H 2 O 2 T=24 hr Pre-G1:2% G0/G1: 52% S: 20% G2/M: 28% DNA content DNA content

24 Supplementary Fig. 16. Karve et al., 2011 B MCF-7 A MCF-7