Phylogenetic Analysis of Deformed Wing Virus Genotypes from Diverse Geographic Origins Indicates Recent Global Distribution of the Virus

Transcription

1 APPLED AND ENVRONMENTAL MCROBOLOGY, June 2007, p Vol. 73, No /07/$ doi: /aem Copyright 2007, American Society for Microbiology. All Rights Reserved. Phylogenetic Analysis of Deformed Wing Virus Genotypes from Diverse Geographic Origins ndicates Recent Global Distribution of the Virus Olga Berényi, 1 Tamás Bakonyi, 1,2 * rmgard Derakhshifar, 3 Hemma Köglberger, 3 Gražyna Topolska, 4 Wolfgang Ritter, 5 Hermann Pechhacker, 6 and Norbert Nowotny 1,7 Zoonoses and Emerging nfections Group, Clinical Virology, Clinical Department of Diagnostic maging, nfectious Diseases and Clinical Pathology, University of Veterinary Medicine, Vienna, A-1210 Vienna, Austria 1 ; Department of Microbiology and nfectious Diseases, Faculty of Veterinary Science, Szent stván University, H-1143 Budapest, Hungary 2 ; nstitute for Apiculture, Agricultural nspection Service and Research Centre Vienna, Austrian Agency for Health and Food Safety and Federal Office for Food Safety, A-1226 Vienna, Austria 3 ; Division of Bee Diseases, Department of Clinical Sciences, Faculty of Veterinary Medicine, Warsaw Agricultural University, PL Warsaw, Poland 4 ; Department of Bee Pathology, CVUA-Animal Health, D Freiburg, Germany 5 ; nstitute for Apiculture, Austrian Agency for Health and Food Safety and Federal Office for Food Safety, A-3293 Lunz, Austria 6 ; and Department of Medical Microbiology, Faculty of Medicine and Health Sciences, United Arab Emirates University, Al Ain, United Arab Emirates 7 Received 27 March 2007/Accepted 2 April 2007 Honeybees originating from 10 different countries (Austria, Poland, Germany, Hungary, Slovenia, Nepal, Sri Lanka, the United Arab Emirates, Canada, and New Zealand) located on four continents were analyzed for the presence of deformed wing virus (DWV) nucleic acid by reverse transcription-pcr. Two target regions within the DWV genome were selected for PCR amplification and subsequent sequencing, i.e., a region within the putative VP2 and VP4 structural-protein genes and a region within the RNA helicase enzyme gene. DWV nucleic acid was amplified from 34 honeybee samples representing all the above-mentioned countries with the notable exception of New Zealand. The amplification products were sequenced, and phylogenetic analyses of both genomic regions were performed independently. The phylogenetic analyses included all sequences determined in this study as well as previously published DWV sequences and the sequences of two closely related viruses, Kakugo virus (KGV) and Varroa destructor virus 1 (VDV-1). n the sequenced regions, the DWV genome turned out to be highly conserved, independent of the geographic origins of the honeybee samples: the partial sequences exhibited 98 to 99% nucleotide sequence identity. Substitutions were most frequently observed at the same positions in the various DWV sequences. Due to the high level of sequence conservation, no significant clustering of the samples in the phylogenetic trees could be identified. On the other hand, the phylogenetic analyses support a genetic segregation of KGV and VDV-1 from DWV. * Corresponding author. Mailing address: Zoonoses and Emerging nfections Group, Clinical Virology, Clinical Department of Diagnostic maging, nfectious Diseases and Clinical Pathology, University of Veterinary Medicine, Vienna, A-1210 Vienna, Austria. Phone: Fax: Tamas.Bakonyi@vu-wien.ac.at. Published ahead of print on 13 April Deformed wing virus (DWV) is probably the most widespread of the so-far-described approximately 18 viruses infecting the honeybee (1, 4, 6, 23). Usually, the virus appears in coexistence with the ectoparasitic mite Varroa destructor (6, 7, 8, 22, 25), which is a highly effective vector of DWV transmission among bees, and the virus is able to replicate in the mite (9, 27, 28, 32). Bee larvae infected during the white-eyed stage of development usually survive the infection initially but develop deformed wings. Shortened abdomens, miscoloring, and a reduction in longevity are other clinical outcomes observed following infection with DWV (4, 34). DWV contains a positive, single-stranded, polyadenylated and monocistronic RNA genome comprising 10,144 nucleotides (nt) (23). The monopartite genome consists of one large, uninterrupted open reading frame encoding the viral polypeptide precursor, which is posttranslationally processed by proteases into active proteins. The N-terminal end of the polypeptide starts with a leader peptide (L protein), followed by the structural proteins VP2, putative VP4, VP1, and VP3. The C-terminal part of the polypeptide contains the nonstructural proteins; conserved motifs of the RNA helicase, the putative VPg protein, the C protease, and the RNA-dependent RNA polymerase (RdRp) were predicted in the deduced amino acid sequence (23) (Fig. 1A). DWV belongs to the unassigned genus flavirus of the insect picorna-like viruses, and serologically it is distantly related to Egypt bee virus (1, 4, 27). Despite the worldwide distribution and frequency of honeybee virus strains, so far only a few studies have focused on the genetic diversity of these viruses. Besides that of DWV, the complete genome sequences of five other honeybee viruses, namely, sacbrood virus (SBV) (19), acute bee paralysis virus (ABPV) (20), black queen cell virus (24), Kakugo virus (KGV) (16), and Kashmir bee virus (12), are available in the GenBank database. The PCR-based detection of the nucleic acid of honeybee viruses is a quick, sensitive, specific, and reliable method for the diagnosis of viral infections in honeybees (8, 10, 18, 30, 34). Direct sequencing of the amplicons and phylogenetic analyses of the sequences provide insight into the genetic relationships among different virus strains. The phylogenetic analysis of SBV (21) and ABPV (5) revealed clustering of the strains according to their geographic origins. The aim of this 3605

2 3606 BERÉNY ET AL. APPL. ENVRON. MCROBOL. FG. 1. Localization of the investigated genome regions of DWV. (A) Schematic depiction of the DWV genome (modified from reference 23 with permission). The shaded box represents the open reading frame, and vertical lines indicate predicted protease cleavage sites in the corresponding polypeptide. Products corresponding to the coding regions are indicated. L, coding region for the L protein; *, coding region for the putative VP4 protein; #, coding region for the putative VPg protein; 3C, coding region for the C protease. (B) Localization of the amplification products obtained by primer pairs listed in Table 1. Shaded boxes indicate amplification products used for the comprehensive phylogenetic analysis of 34 DWV genotypes. (C) DWV sequences available in the GenBank database. Shaded boxes represent the sequences obtained in this study. The geographic origins of the sequences are indicated on the left, and the GenBank accession numbers are shown on the right. **, 34 DWV strains from nine countries and three continents. study was to analyze the phylogenetic relatedness of DWV strains collected from different regions of the world and to assess the genetic diversity of this virus. MATERALS AND METHODS Samples. Thirty-seven honeybee specimens, some exhibiting clinical symptoms characteristic of DWV infection, were collected in 2003 and sent to us by collaborating colleagues. The specimens originated from five European countries, Austria (nine samples), Poland (five samples), Germany (three samples), Hungary (five samples), and Slovenia (four samples), as well as from Nepal (two samples), Sri Lanka (two samples), the United Arab Emirates (two samples), Canada (two samples), and New Zealand (three samples). The samples were stored at 20 C until they were investigated. solation of RNA. The bees were homogenized in sterile ceramic mortars with sterile sand; thereafter, diethyl pyrocarbonate-treated water was added. The homogenates were centrifuged at 20,000 g for 1 min, and 140 l ofthe supernatant was used for RNA extraction by employing the QAamp viral RNA mini kit according to the instructions of the manufacturer (QAGEN, Hilden, Germany). Primer design. Eight primer pairs were selected based on the complete DWV genomes deposited in the GenBank database under accession numbers NC_ and AY (Fig. 1B) by employing a primer designer program (Scientific and Educational Software, version 4.1). At first the primers were tested with one Austrian DWV strain by amplifying different genomic regions of the virus. The amplification products were sequenced and compared with the previously mentioned complete genome records from GenBank. For a more comprehensive analysis, four primer pairs that were expected to produce overlapping amplification products corresponding to the partial VP2, putative VP4, and VP1 structural-protein genes and the partial RNA helicase enzyme coding genome region were selected (Fig. 1B). These primer pairs were applied in reverse transcription-pcr (RT-PCR) assays to the remaining 36 DWV samples. Since in the case of the first two primer pairs, the overlapping area was only 19 bases long, another primer pair corresponding to this region was designed in order to create a longer overlapping genome stretch. The primer sequences, orientations, and locations and the expected sizes of the amplified products are shown in Table 1. RT-PCR. DWV RNA was reverse transcribed, and selected regions of the genome were amplified with a continuous-rt-pcr method by using a One Step RT-PCR kit according to the recommendations of the manufacturer (QAGEN). The amplifications were performed in GeneAmp PCR System 2400 thermocyclers (Applied Biosystems). The temperature profile for the RT-PCR was as follows: 30 min at 50 C (reverse transcription) and 15 min at 95 C (denaturation and HotStarTaq activation), followed by 40 cycles of amplification with 30 s at 94 C, 50 s at 55 C, and 1 min at 72 C. Reactions were completed with a final elongation step for 7 min at 72 C. RNA extracts from bees without DWV infection were used as negative controls. The PCR products were electrophoresed on a 1.2% Tris-acetate-EDTA-agarose gel and stained with ethidium TABLE 1. Oligonucleotide primers employed for the amplification of selected DWV genome regions Amplification product no. a Primer name b Primer sequence (5 to 3 ) Length of amplified product (bp) 1 DWV 20f CGAATTACGGTGCAACTAAC 559 DWV 578r ACAATAGATGGTCGGTGACA 2 DWV 1848f TAACAACTCAGCGAGATCCT 517 DWV 2364r GTAGTCCAATCTGGCACAAT 3 DWV 2115f CGAGGCGATATGGAAGTTAG 324 DWV 2438r ACAGGTAGTTGGACCAGTAG 4 DWV 2345f ATTGTGCCAGATTGGACTAC 435 DWV 2779r AGATGCAATGGAGGATACAG 5 DWV 3407f CCATATTATGCTGGAGTGTG 481 DWV 3887r TGGTCGTATCCAAGACTGTA 6 DWV 3994f CGTTACTACGGATAAGGATA 548 DWV 4541r GCATACCATCTCCAATACTA 7 DWV 4759f TCTTCAACAACCGGAGGTTC 527 DWV 5285r TCTCAGGCTCGTCATTCACA 8 DWV 5992f TCCTATTGCTGAATGTAGTC 463 DWV 6454r CGAACTCATAACCTCATAAG 9 DWV 6285f GAGCGTACACTATGGTCAGA 409 DWV 6693r GTTCACGACGCTTACTACAC 10 DWV 8934f CCTATCGAGCTGCACGACTT 666 DWV 9599r CCGAGACCTTGTCCAGGTTA a Numbers correspond to those in Fig. 1B. b Numbers refer to the annealing positions of the 5 -end nucleotides of the primers according to the reference complete DWV sequence (GenBank accession no. AY292384). f, forward primer; r, reverse primer. Primers in italics were applied for the comprehensive phylogenetic analyses of 34 DWV genotypes.

3 VOL. 73, 2007 PHYLOGENY OF DEFORMED WNG VRUS 3607 bromide. Bands were photographed with a Kodak DS electrophoresis documentation and analysis system using the Kodak Digital Science 1D software program. Fragment sizes were determined with reference to a 100-bp ladder (Promega). Nucleotide sequencing and phylogenetic analysis. The PCR products were excised from the gel and extracted by employing the QAquick gel extraction kit according to the instructions of the manufacturer (QAGEN). Fluorescencebased direct sequencing of the amplicons in both directions was performed by using the AB PRSM BigDye Terminator cycle-sequencing ready-reaction kit (21). The nucleotide sequences were identified by the basic local alignment search tool BLAST (2) and aligned by employing the Align Plus program (Scientific and Educational Software, version 4.1). Multiple alignments for phylogenetic analyses were created with the help of the ClustalX program (33). Phylogenetic analyses were conducted by using the PAUP*4.0 beta 10 version (29) with maximum-parsimony, distance (neighbor-joining), and maximum-likelihood criteria. Bootstrap analyses of 1,000 replicates of the parsimony and distance trees were performed. The same data sets were also analyzed by using the PHYLP package 3.6 beta version (15) with maximum-parsimony, distance (neighbor-joining, fitch, and kitsch), and maximum-likelihood algorithms. Trees were drawn with the help of the TreeView software. Nucleotide sequence accession numbers. The DWV sequences described in this paper were submitted to the GenBank database under accession numbers DQ to DQ RESULTS Comparison of the levels of variability of different genomic regions. At first, eight DWV-specific primer pairs were applied to one DWV-positive Austrian honeybee sample (the infecting strain was designated Austria-1) (Fig. 1B). The PCR products were observed after electrophoresis as clear and distinct bands corresponding to the expected molecular sizes. Amplification products never occurred in the negative controls. The amplification products were sequenced in both directions, and the sequences were aligned with the reference sequences with accession numbers NC_ and AY (23). n total, 3,985 nt of the DWV strain Austria-1, or 39% of the complete genome, were determined (Fig. 1C). Sequence alignments revealed a low level of sequence divergence among the DWV genomes investigated and a rather regular distribution of the few nucleotide differences. The talian strain (NC_004830) exhibited 27 nucleotide substitutions (0.7%) compared to the strain from the United States (AY292384), while strain Austria-1 differed at 28 nt (0.7%) and 40 nt (1%) from the talian and U.S. strains, respectively. t is also important that the complete genome record of DWV deposited under the accession number NC_ (derived from the sequence deposited under accession number AJ489744) contains 69 not-exactlyidentified nucleotides (indicated by K, R, W, and Y), of which 23 are located in the genome regions investigated in this study; they were excluded from the previous calculations. Within these loci, the U.S. and Austrian sequences always confirmed the choices, but at eight positions these two strains differed from each other as well; therefore, it is not possible to decide which of the two sequences is more similar to the talian sequence. All partial nucleotide sequences of DWV strains found in GenBank were also aligned with the complete genome records and, when applicable, with the sequences obtained in this study (Fig. 1C). A 4,700-nt-long sequence covering the complete nonstructural-protein coding region of a DWV strain from France (France-1) was previously deposited in GenBank under accession number AY The sequence is 98% similar to those of the corresponding regions in the complete genome records of the taly-1 and USA-1 strains (23) and 98 to 99% similar to the sequences obtained in this study and to other sequences deposited in GenBank. The 5 untranslated regions of the talian, U.S., and Austria-1 sequences were aligned with a sequence from a DWV strain detected in Costa Rica (accession number DQ139981). These sequences exhibited 98 to 99% identity to one another. Another genome stretch of the same Costa Rican genotype in the putative VPg protein coding region is available under accession number DQ This region is 98% similar to the corresponding sequences of the taly-1, USA-1, and France-1 strains. Sequence information on the partial RdRp coding regions of 15 DWV strains was found in GenBank: besides those from the taly-1, USA-1, and France-1 strains, sequences of the RdRp coding regions from two additional strains from France (accession numbers DQ and DQ139982) (31), one strain from Uruguay (accession number DQ364631) (3), and nine strains from Spain (accession numbers DQ to DQ385507) were available. The RdRp coding regions in these genotypes showed again 98 to 99% similarity to the corresponding regions of the reference sequences. Phylogenetic analyses of DWV genotypes. Because the aforementioned comparisons did not reveal regions of higher diversity than others in the investigated genome stretches of the talian, U.S., and Austrian DWV strains, two regions were selected for further analyses on the basis of their putative functions. n viruses of vertebrates, frequently the structural proteins (antigens) are subjected to immunoselection, and therefore the corresponding genes often contain hypervariable regions. n contrast, nonstructural proteins (enzymes) are usually more conserved, because mutations may disturb their efficacy. Such tendencies in viruses of invertebrates have not been recorded so far, and therefore, we decided to compare the levels of variability of corresponding partial structuralprotein coding regions and partial nonstructural-protein coding regions from DWV samples collected from all over the world: a genome stretch between nucleotide positions 1967 and 2731, located in the VP2, putative VP4, and VP1 structural-protein coding region, and a genome stretch between nucleotide positions 6053 and 6614, located in the putative RNA helicase coding region. RT-PCR assays of the remaining 36 honeybee samples were performed with primer pairs which result in overlapping PCR amplification products. The selected regions were amplified in 33 samples. nterestingly, all three samples originating from New Zealand proved to be negative for these regions in all RT-PCR assays employed. The amplicons from the positive samples were directly sequenced in both directions. The sequences were compiled and aligned by using the complete DWV sequences deposited in GenBank as references. After the completion of these investigations, continuous sequence information was available from every investigated DWV sample for a 764-nt fragment within the putative VP2-VP1 capsid protein gene region and a 562-nt fragment within the helicase gene region. Together, the two fragments cover 13% of the complete DWV genome. The sequences were 98 to 99% similar to those of the reference strains; nucleotide substitutions at 50 positions within the structural-protein coding fragment and at 49 positions within the helicase coding fragment were observed. A more detailed investigation of these positions revealed that at each position, the nucleotides in the studied DWV genotypes always varied between two

4 3608 BERÉNY ET AL. APPL. ENVRON. MCROBOL. TABLE 2. Substitutions in the deduced amino acid sequences corresponding to the investigated DWV genotypes a Strain Substitution in the VP2-VP1 region at amino acid: Substitution in RNA helicase at amino acid: taly-1 N S N T L V A V A P Austria-1 L Austria-3 Austria-4 Austria-5 V Austria-6 Austria-7 V Austria-9 Canada-1 K L T Canada-2 L Germany-2 L Hungary-2 M Poland-2 N S Poland-5 T Slovenia-2 V Slovenia-3 V USA-1 D L a Amino acid positions refer to protein sequence CAD34006 (23). alternatives. The distribution of the transitions did not show any tendencies: for instance, at position 6430 in 14 genotypes, cytosine was found, and in 23 genotypes, uracil was present; at position 6565, 17 genotypes contained adenine and 20 contained guanine; and at position 6604, 20 sequences exhibited uracil and 17 exhibited cytosine, regardless of the geographic origins of the strains. The putative amino acid sequences corresponding to the two investigated DWV genome stretches were also determined, and these amino acid sequences were aligned and compared. Amino acid substitutions at four positions within the capsid protein region and at seven positions in the helicase protein region were found (Table 2). Phylogenetic trees were constructed based on the aforementioned nucleotide sequences to illustrate the probable genetic relationships among the genotypes. The corresponding region of the DWV strain France-1 (accession number AY224602) (17) was also included in the alignment and phylogenetic tree of the helicase coding regions. Two closely related viruses, KGV (accession number NC_005876) (16) and Varroa destructor virus 1 (VDV-1; NC_006494) (27), were included in the analyses, and VDV-1 was used as the outgroup. The phylogenetic trees based on the structural-protein coding regions and the helicase coding regions are shown in Fig. 2 and 3, respectively. As was already indicated by the high levels of genetic similarity, the DWV genotypes exhibit short genetic distances between each other. Certain sequences proved to be essentially identical to one another, and in general very close genetic relationships are indicated by the trees, independent of the geographic origins of the samples. Different statistical algorithms (maximum-parsimony, distance matrix, and maximumlikelihood criteria) were applied; nonetheless, essentially the same tree structures were obtained by using PAUP* (29) and PHYLP (15) software packages. Therefore, only the phylogenies resulting from the PAUP analysis are shown in Fig. 2 and 3. Due to the low level of sequence divergence, in many cases the bootstrap analysis revealed low values of confidence, indicating that the present clustering is statistically poorly supported. Since the bootstrap values are of no significance in this FG. 2. Phylogram illustrating the genetic relationships among DWV genotypes, based on the partial structural-polypeptide coding region between nucleotide positions 1967 and The phylogram was constructed by PAUP* using maximum-parsimony criteria. VDV-1 was used as the outgroup, and the branch length of VDV-1 was reduced by 400% to increase resolution. Scale bars indicate the numbers of steps for parsimony analysis; the bootstrap support value is indicated only for the DWV/KGV VDV-1 node. U.A.E., United Arab Emirates.

5 VOL. 73, 2007 PHYLOGENY OF DEFORMED WNG VRUS 3609 within the helicase coding region, they show a close relationship to the sequence of a DWV strain collected in the United Arab Emirates. n comparing the two trees, very few similarities are found in the structures of clustering and in the members of the various subbranches. To summarize, the DWV phylogeny based on the genetic analysis and comparison of viruses collected in various parts of the world many thousands of kilometers apart indicates a high degree of genome conservation in DWV. DSCUSSON FG. 3. Phylogram illustrating the genetic relationships among DWV genotypes, based on the partial RNA helicase coding region between nucleotide positions 6053 and The phylogram was constructed by PAUP* using maximum-parsimony criteria. VDV-1 was used as the outgroup, and the branch length of VDV-1 was reduced by 400% to increase resolution. Scale bars indicate the numbers of steps for parsimony analysis; the bootstrap support value is indicated only for the DWV/KGV VDV-1 node. U.A.E., United Arab Emirates. case, they have been omitted in Fig. 2 and 3. KGV and VDV-1 form distinct monophyletic branches, and their separation from the DWV genotypes is supported by bootstrap analyses. The DWV sequences derived from bee samples collected in remote geographic regions do not show phylogenetic segregation: in some cases, viruses from Europe cluster together with viruses from Asia. The North American sequences are relatively separated; however, in the tree based on sequences Phylogenetic analysis of nucleotide sequences derived from different strains of the same virus is usually a useful tool to describe the diversity of the virus and to identify the origins of newly emerging strains or to monitor the spread of certain genotypes (5, 21). The genetic separation of viruses is influenced mainly by the number of replication cycles (the approximate time required for replication), the accuracy of replication, and the phenotypic effects of mutations. The number and distribution of mutations are analyzed by the phylogenetic algorithms to infer the probable genetic relationships among the investigated strains. Therefore, a higher level of sequence diversity provides more information and hence a higher level of confidence in the inference. The genetic diversity of two other honeybee viruses, ABPV and SBV, was investigated previously by our research group by using the same methods applied in this study of DWV (5, 21). When ABPV strains from different continents (Europe and North America) were compared, nucleotide similarity levels varied between 89 and 91% (at the structural-polyprotein partial coding sequence) (5). n the case of SBV, the other beeinfecting member of the flavirus genus, isolates from Europe were 90 to 94% similar to Asian strains and 78 to 83% similar to a South African strain in different coding regions of the genome (21). Virus strains from the same continents or from the same countries showed higher levels of similarity, and phylogenetic analyses unambiguously indicated the genetic clustering of the strains according to their geographic origins. Practically, this means that these viruses have been present in the honeybee populations for a long time, that an exchange of viruses among the host populations has been infrequent, and that therefore, the viruses have evolved more or less independently. The DWV genotypes investigated in this study, however, showed similarity levels of 98%, regardless of the genome stretch investigated and the geographic origins of the viruses. Although the genotypes are very similar to one another, nucleotide substitutions predominantly transitions were observed at certain loci from several viruses, indicating the divergence of these genotypes. Notwithstanding, the phylogenetic analyses could not confirm the shared derived character of these nucleotide substitutions. Due to the low level of diversity, the statistical analysis could not reveal significant clustering of the investigated DWV genotypes, except for their separation from those of KGV and VDV-1. Although the comprehensive phylogenetic analysis of the 34 strains was applied to only two selected regions of the DWV genome, an analysis of the sequence data for other regions obtained by independent research groups indicated similarly

6 3610 BERÉNY ET AL. APPL. ENVRON. MCROBOL. low levels of sequence diversity among different virus strains from Europe and South America. The nucleotide sequences of seven amplification products from a DWV strain from Germany were identified by Genersch (18). The partial nucleotide sequences covered 31% of the DWV genome, spanning between the VP1 and RdRp coding regions. Levels of similarity to the published complete sequences varied between 98.9 and 99.7%. Because the sequences obtained in that study have not yet been deposited in gene bank databases, they could not be included in the present analysis, but the similarity values further support our findings. DWV was first detected in honeybees from Japan in the early 1980s (4, 23). Since that time, DWV has usually been found in honeybee colonies infested with V. destructor. The natural host of this parasitic mite is Apis cerena, present in the Far East regions of Asia. The mite first emerged on Apis mellifera, also in Japan (where the European honeybee was introduced in 1876), at the beginning of the 20th century. Due to the international and transcontinental trade of varroa miteinfested honeybees, the mite has spread all around the world s honeybee population within the last 50 years (4). Quantitative analyses of the DWV loads in V. destructor indicate that the mite is an efficient host for the multiplication of the virus (28, 32, 34). Although the mite plays a central role in the transmission of DWV, previous investigations revealed alternative routes for the spread of the virus as well (9, 10, 11, 26, 34). Although DWV has been detected in varroa mite-free colonies, too, these findings were reported after the mite was introduced into the particular country where the investigations were made (3, 9, 11, 18, 22, 26, 28, 31, 34). The transient varroa mite-free status of apiaries could easily be achieved by employing acaricide treatments, but these obviously do not influence the previously acquired DWV-infected status of the colonies. Moreover, infected bees can transmit the virus to other colonies via the previously reported alternative routes. Reports on the presence of DWV in bee colonies unambiguously independent from V. destructor infestation were not found in the scientific literature. The results of this study indicate that the investigated DWV genotypes belong to one close monophyletic cluster of the virus, despite the fact that the viruses originated from distant geographic regions. DWV was presumably introduced into the honeybee populations more recently than other common bee viruses (e.g., ABPV and SBV), and its evolutionary divergence is just at its beginning. Because the virus multiplies sufficiently in V. destructor, it is possible that an originally mite-infecting virus has adapted recently to A. mellifera or that the virus was transmitted from A. cerena with the help of the arthropod vector. The worldwide occurrence of the virus is most probably the result of the emergence and spread of V. destructor during recent decades. n this context, it is noteworthy that the three investigated honeybee samples from New Zealand were the only ones in our study which were DWV negative. Further analyses involving DWV genotypes from A. cerena, or other bee species, as well as from varroa mites may reveal the origin of DWV infection in the honeybee. Two viruses that are closely related to DWV but nonetheless distinct have been identified so far, i.e., KGV and VDV-1. While KGV was isolated in Japan from A. mellifera (16), VDV-1 was detected in Europe in V. destructor (27). Although these viruses are considered by some authors (23) to be biological and geographic variants of DWV, their segregation from the worldwide common DWV genogroup is indicated by the results of this study. ACKNOWLEDGMENTS This study was partially supported by the grants OTKA F and D REFERENCES 1. Allen, M., and B. V. Ball The incidence and world distribution of honey bee viruses. Bee World 77: Altschul, S. F., T. L. Madden, A. A. Schäffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman Gapped BLAST and PS-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25: Antunez, K., B. D Alessandro, E. Corbella, G. Ramallo, and P. Zunino Honeybee viruses in Uruguay. J. nvertebr. Pathol. 93: Bailey, L., and B. V. Ball Honey bee pathology, 2nd ed., p , Academic Press, London, United Kingdom. 5. Bakonyi, T., E. Grabensteiner, J. Kolodziejek, M. Rusvai, G. Topolska, W. Ritter, and N. Nowotny Phylogenetic analysis of acute bee paralysis virus strains. Appl. Environ. Microbiol. 68: Ball, B. V The association of Varroa jacobsoni with virus diseases of honey bees, p n R. Cavallovo (ed.), Varroa jacobsoni Oud affecting honey bees: present status and needs. Commission of the European Communities, Wageningen. A. A. Balkema, Rotterdam, The Netherlands. 7. Ball, B. V Varroa and viruses, p n P. Munn and R. Jones (ed.), Varroa! Fight the mite. nternational Bee Research Association, Cardiff, United Kingdom. 8. Benjeddou, M., N. Leat, M. Allsopp, and S. Davison Detection of acute bee paralysis virus and black queen cell virus from honeybees by reverse transcriptase PCR. Appl. Environ. Microbiol. 67: Bowen-Walker, P. L., S. J. Martin, and A. Gunn The transmission of deformed wing virus between honeybees (Apis mellifera L.) by the ectoparasitic mite Varroa jacobsoni Oud. J. nvertebr. Pathol. 73: Chen, Y. P., J. A. Higgins, and M. F. Feldlaufer Quantitative real-time reverse transcription-pcr analysis of deformed wing virus infection in the honeybee (Apis mellifera L.). Appl. Environ. Microbiol. 71: Chen, Y. P., J. S. Pettis, A. Collins, and M. F. Feldlaufer Prevalence and transmission of honeybee viruses. Appl. Environ. Microbiol. 72: de Miranda, J. R., M. Drebot, S. Tyler, M. Shen, C. E. Cameron, D. B. Stoltz, and S. M. Camazine Complete nucleotide sequence of Kashmir bee virus and comparison with acute bee paralysis virus. J. Gen. Virol. 85: Reference deleted. 14. Reference deleted. 15. Felsenstein, J PHYLP phylogeny inference package, version 3.6b. Department of Genome Sciences, University of Washington, Seattle, WA. 16. Fujiyuki, T., H. Takeuchi, M. Ono, T. Sasaki, A. Nomoto, and T. Kubo Novel insect picorna-like virus identified in the brains of aggressive worker honeybees. J. Virol. 78: Reference deleted. 18. Genersch, E Development of a rapid and sensitive RT-PCR method for the detection of deformed wing virus, a pathogen of the honeybee (Apis mellifera). Vet. J. 169: Ghosh, R. C., B. V. Ball, M. M. Willcocks, and M. J. Carter The nucleotide sequence of sacbrood virus of the honey bee: an insect picornalike virus. J. Gen. Virol. 80: Govan, V. A., N. Leat, M. Allsopp, and S. Davison Analysis of the complete genome sequence of acute bee paralysis virus shows that it belongs to the novel group of insect-infecting RNA viruses. Virology 277: Grabensteiner, E., W. Ritter, M. J. Carter, S. Davison, H. Pechhacker, J. Kolodziejek, O. Boecking,. Derakshifar, R. Moosbeckhofer, E. Licek, and N. Nowotny Sacbrood virus of the honeybee (Apis mellifera): rapid identification and phylogenetic analysis using reverse transcription-pcr. Clin. Diagn. Lab. mmunol. 8: Hung, A. C. F., H. Shimanuki, and D. A. Knox The role of viruses in bee parasitic mite syndrome. Am. Bee J. 136: Lanzi, G., J. R. de Miranda, M. B. Boniotti, C. E. Cameron, A. Lavazza, L. Capucci, S. M. Camazine, and C. Rossi Molecular and biological characterization of deformed wing virus of honeybees (Apis mellifera L.). J. Virol. 80: Leat, N., B. Ball, V. Govan, and S. Davison Analysis of the complete genome sequence of black queen-cell virus, a picorna-like virus of honey bees. J. Gen. Virol. 81: Nordström, S.,. Fries, A. Aarhus, H. Hansen, and S. Korpela Virus infection in Nordic honey bee colonies with no, low or severe Varroa jacobsoni infestations. Apidologie 30: Nordström, S Distribution of deformed wing virus within honey bee

7 VOL. 73, 2007 PHYLOGENY OF DEFORMED WNG VRUS 3611 (Apis mellifera) brood cells infested with the ectoparasitic mite Varroa destructor. Exp. Appl. Acarol. 29: Ongus, J. R., D. Peters, J. M. Bonmatin, E. Bengsch, J. M. Vlak, and M. M. van Oers Complete sequence of a picorna-like virus of the genus flavirus replicating in the mite Varroa destructor. J. Gen. Virol. 85: Shen, M., X. Yang, D. Cox-Foster, and L. Cui The role of varroa mites in infections of Kashmir bee virus (KBV) and deformed wing virus (DWV) in honey bees. Virology 342: Swofford, D. L PAUP*: phylogenetic analysis using parsimony (*and other methods), version 4. Sinauer Associates, Sunderland, MA. 30. Tentcheva, D., L. Gauthier, S. Jouve, L. Canabady-Rochelle, B. Dainat, F. Cousserans, M. E. Colin, B. V. Ball, and M. Bergoin Polymerase chain reaction detection of deformed wing virus (DWV) in Apis mellifera and Varroa destructor. Apidologie 35: Tentcheva, D., L. Gauthier, N. Zappulla, B. Dainat, F. Cousserans, M. E. Colin, and M. Bergoin Prevalence and seasonal variations of six bee viruses in Apis mellifera L. and Varroa destructor mite populations in France. Appl. Environ. Microbiol. 70: Tentcheva, D., L. Gauthier, L. Bagny, J. Fievet, B. Dainat, F. Cousserans, M. E. Colin, and M. Bergoin Comparative analysis of deformed wing virus (DWV) RNA in Apis mellifera L. and Varroa destructor. Apidologie 37: Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25: Yue, C., and E. Genersch RT-PCR analysis of Deformed wing virus in honeybees (Apis mellifera) and mites (Varroa destructor). J. Gen. Virol. 86: