Flag-Rac Vector V12 V12 N17 C40. Vector C40 pakt (T308) Akt1. Myc-DN-PAK1 (N-SP)

Transcription

1 a b FlagRac FlagRac V2 V2 N7 C4 V2 V2 N7 C4 p (T38) p (S99, S24) p Flag (Rac) NIH 3T3 COS c +Serum p (T38) MycDN (NSP) Mycp min p Myc ( or p27) Figure S (a) Effects of Rac mutants on phosphorylation of. NIH 3T3 cells were transfected with either control vector or a plasmid encoding Flagtagged Rac (Rac V2, Rac V2C4 or Rac N7 ), together with a plasmid encoding wildtype ( WT ) for 8 h. Cell lysates were subjected to immunoblotting with antibodies to phosphorylated (at Thr38 or Ser473) or. (b) Effects of Rac mutants on phosphorylation of PAK. COS cells were transfected as described in Fig. a. Cell lysates were subjected to immunoblotting with antibodies to phosphorylated (at Ser99 and Ser24), or Flag (for Rac). Rac N7 (DNRac) was included as a negative control. The C4 mutation effectively abolished the ability of Rac V2 to stimulate PAK phosphorylation, as previously described in other systems. (c) Requirement of PAK for growth factorinduced phosphorylation of. COS cells were transfected with either control vector, a plasmid encoding Myctagged DN ( NSP ) or Myctagged p27, together with a plasmid encoding WT for 8 h. Cells were serumstarved for 5 h COS and then stimulated with % FBS (Serum) for the indicated times before harvesting. Cell lysates were subjected to immunoblotting with antibodies to phosphorylated (at Thr38 or Ser473), or Myc (for or p27). We used a plasmid encoding Mycp27 (which has a similar molecular weight with NSP ) as another control from which a protein is expressed. (df) Requirement of PAK for growth factorinduced phosphorylation of. NIH 3T3 cells (d), mouse embryonic fibroblasts (MEF) (e) or COS cells (f) were transfected with two different sets of sirnas (# for (d), #2 for (e) or # and #2 for (f)) for either and PAK2 or their corresponding control sirnas for 3 d. Cells were serumstarved in 2% FBS (d, e) or % FBS (f) for 5 h and then stimulated with 2 ng/ml PDGF (d, e) or % FBS (Serum) (f) for the indicated times before harvesting. Cell lysates were subjected to immunoblotting with antibodies to phosphorylated (at Thr38 or Ser473),,, PAK2 or GAPDH. Results are presented as mean ±SD from three independent experiments. (*P <.3; ttest, **P <.3; ttest)

2 d Control sirna# PAK2 sirna# +PDGF p (T38) p PAK2 GAPDH NIH 3T3 min.2.2 * * p (T38)/ p / PAK2 sirna# + + PAK2 sirna# PDGF (3min) + PDGF (3min) + Figure S continued 2

3 e Control sirna#2 PAK2 sirna#2 +PDGF min p (T38) p PAK2 GAPDH WT MEF.2.2 * * p (T38)/ p / PAK2 sirna#2 + + PAK2 sirna#2 + + PDGF (5min) + PDGF (5min) + Figure S continued 3

4 f Control sirna# PAK2 sirna# +Serum min p (T38) p PAK2 GAPDH COS.2 **.2 ** p (T38)/ p / PAK2 sirna# + + PAK2 sirna# Serum (5min) + Serum (5min) +.2 *.2 * p (T38)/ p / PAK2 sirna#2 Serum (5min) PAK2 sirna#2 Serum (5min) Figure S continued 4

5 a LF KN CKN (Nterm) Myc () NIH 3T3 b p p p p Overlay Overlay Figure S2 (a) Expression of LF, KN and CKN in NIH 3T3 cells. Cells were transfected as described in Fig. 2b. Cell lysates were subjected to immunoblotting with antibodies to PAK (Nterm), Myc (for ) or. (b) Phosphorylated colocalizes with phosphorylated at the leading edge of polarized fibroblasts. (left panel) NIH 3T3 cells were plated on coverslips and cultured for 2 h. Cells were then fixed and stained with antibodies to phosphorylated (at Ser99 and Ser24) and phosphorylated (at Ser473). Note that Phosphorylated colocalizes with phosphorylated at the leading edge of cells (arrowheads). Scale bar, 2 µm. (right panel) Enlarged images of boxed areas in left panel. 5

6 a +PDGF Membrane Cytosol DN (NSP) DN (NSP) min Myc () βintegrin αtubulin b +EGF NIH 3T3 Membrane Cytosol DN (NSP) DN (NSP) min Myc () βintegrin αtubulin COS Mycp2c +PDGF (min) Membrane Myc DN PAK Mycp Cytosol Myc DN PAK βintegrin αtubulin NIH 3T3 Figure S3 Inhibition of PAK impairs membrane translocation of. (a, b) NIH 3T3 cells (a) or COS cells (b) were transfected with either control vector or a plasmid encoding Myctagged DN ( NSP ), together with a plasmid encoding WT for 8 h. Cells were serumstarved in 2% FBS (a) or % FBS (b) for 5 h and then stimulated with 2 ng/ml PDGF (a) or ng/ml EGF (b) for the indicated times. Cells were then subjected to subcellular fractionation as described in Methods, and the amounts of or Myctagged DN ( NSP ) in the membrane and cytosolic fractions were analyzed by immunoblotting with antibodies to or Myc (for ). The amounts of the membrane marker βintegrin and cytosolic marker αtubulin were used as internal controls. (c) NIH 3T3 cells were transfected with either control vector, a plasmid encoding Myctagged DN ( NSP ) or Myctagged p27, together with a plasmid encoding WT for 8 h. Cells were serumstarved in 2% FBS for 5 h and then stimulated with 2 ng/ml PDGF for min. Cells were then subjected to subcellular fractionation as described in Methods, and the amounts of in the membrane and cytosolic fractions were analyzed by immunoblotting with antibody to. (d) NIH 3T3 cells were transfected with sirnas for or 2 or their corresponding control sirnas for 3 d. Cells were then fixed and stained with antibodies to or 2. Scale bar, 2 µm. (e, f) NIH 3T3 cells were transfected with sirnas for either and PAK2 (#2) or their corresponding control sirnas for 3 d. Cells were serumstarved in 2% FBS for 4 h and then stimulated with or without 2 ng/ml PDGF for 5 min. Cells were then fixed and stained with antibodies to (d) or 2 (e). (g, h) NIH 3T3 cells were transfected with HAtagged or HAtagged 2 together with either control vector or a plasmid encoding Myctagged NSP for 8 h. Cells were serumstarved in 2% FBS for 4 h and then stimulated with or without 2 ng/ml PDGF for 5 min. Cells were then fixed and stained with antibodies to HA (for or 2). Scale bar, 2 µm. (i) is necessary for efficient phosphorylation of Thr38 but not Ser473 in the membranetargeted form of. NIH 3T3 cells were transfected with either control vector or a plasmid encoding Myctagged DNPAK ( NSP ), together with a plasmid encoding PH (PH domain truncated ) or m PH (PH domain truncated with a myristoylation site) for 8 h. Cells were serumstarved for h and then subjected to subcellular fractionation as described in Methods. Total cell lysates were subjected to immunoblotting with antibodies to phosphorylated (at Thr38 or Ser473), or Myc (for ). Results are presented as mean ±SD from three independent experiments. (*P < 3 5 ; ttest) 6

7 d Control sirna# sirna# Control sirna# 2 2 sirna# Figure S3 continued 7

8 e (endogenous) Control sirna#2 PDGF /2 sirna#2 Control sirna#2 +PDGF /2 sirna#2 f 2 (endogenous) Control sirna#2 PDGF /2 sirna#2 Control sirna#2 +PDGF /2 sirna#2 Figure S3 continued 8

9 g HA (transfected) PDGF PAK NSP +PDGF PAK NSP h HA2 (transfected) PDGF PAK NSP +PDGF PAK NSP Figure S3 continued 9

10 i ΔPH mδph Myc NSP + p (T38) p (ΔPH or mδph) Myc () Total extract.4 Myc NSP (ΔPH or mδph) Membrane ΔPH mδph PDK Myc () βintegrin αtubulin mδph + ΔPH Cytosol mδph + NIH3T3.2 * p/ NSP + + p T38 p S473 Figure S3 continued

11 a PAK2 IP : PDK Total extract Serum sirna#2 + + PDK PDK + b Migration Index NIH3T3 3A 3A 3A Rac V2 CKN Figure S4 (a) Knockdown of PAK impairs complex formation between endogenous PDK and in PDGFstimulated NIH 3T3 cells. NIH 3T3 cells were transfected with sirnas (#2) for either and PAK2 or their corresponding control sirnas for 3 d. Cells were cultured in the presense or absense of % FBS (Serum) for 5 h. Cell lysates were subjected to immunoprecipitation with antibody to PDK, and then subjected to immunoblotting with antibodies to or PDK. (b) Inhibition of prevents stimulated cell motility in NIH 3T3 cells. NIH 3T3 cells were transfected with either control vector or a plasmid encoding Flagtagged Rac V2 or Myctagged CKN and DN ( 3A ) together with a plasmid encoding EGFP for 8 h. Cells were then transferred to the upper compartment of a modified Boyden chamber. After 2 h, the number of GFPpositive cells that had migrated through the membrane was determined. Results are presented as mean ±SD from three independent experiments.

12 a Nuclear Membrane Cytosol Myc NSP Serum p substrate p βintegrin αtubulin Lamin A/C b + Serum p (T38) Myc NSP min p pfoxo3a FOXO3a ps6k pbad pgsk3 GSK3β Myc (PAK) Figure S5 Inhibition of PAK prevents only a part of the mediated processes. (a) Inhibition of PAK reduces phosphorylation of only a subset of substrates. COS cells were transfected with either control vector or a plasmid encoding Myctagged DN ( NSP ) for 8 h. Cells were serumstarved for 5 h and then stimulated with % FBS (Serum) for 5 min before harvesting. Cells were then subjected to subcellular fractionation as described in Methods, and the amount of, phosphorylated (at Ser473) or the phosphorylation of putative substrates were determined by immunoblotting. The amounts of the nuclear marker Lamin A/C, membrane marker βintegrin and cytosolic marker αtubulin were used as internal controls. Note that the intensities of some bands in the putative substrate immunoblotting (indicated by arrows) were specifically reduced by expression of DN ( NSP ). (b) COS cells were transfected with either control vector or a plasmid encoding Myctagged DN ( NSP ) for 8 h. Cells were serumstarved for 5 h and then stimulated with % FBS (Serum) for indicated times before harvesting. Cell lysates were subjected to immunoblotting with antibodies to phosphorylated (at Thr38 or Ser473),, phosphorylated Foxo, Foxo, phosphorylated GSK3, GSK3β or Myc (for ). (c) NIH 3T3 cells were transfected with either control vector, a plasmid encoding DN ( 3A ) or Myctagged DN ( NSP ) together with a plasmid encoding GFPHistone H2B for 8 h. Cells were serumstarved for 6 h and were subjected to a cell death assay detecting chromatin condensation. Results are presented as mean ±SD of values obtained from three fields of 52 cells in each of three independent experiments. (*P <.; ttest) (d) NIH 3T3 cells were transfected with either control vector, a plasmid encoding DN ( 3A ) or Myctagged DN ( NSP ) for 8 h. Cells were then metabolically labeled with [ S]methionine for h. Cell lysates were resolved by SDS PAGE and were detected by autoradiography. Results are presented as mean ±SD from three independent experiments. *P <.2, **P <.3; ttest) (e) NIH 3T3 cells were transfected with either control vector, a plasmid encoding DN ( 3A ) or Myctagged DN ( NSP ) together with a plasmid encoding EGFP for 8 h. Cells were then counted and mixed with cells transfected with control vector together with a plasmid encoding mrfp, achieving equal numbers of GFPpositive and mrfppositive cells. This mixture suspension was then transferred to the upper compartment of a matrigel invasion chamber. After 2 h, the numbers of GFPpositive and mrfppositive cells that had migrated through the membrane were determined. Results are presented as mean ±SD from three independent experiments. (*P <.5; ttest) 2

13 Chromatin condensation (%) c * * 3A e d [ S]methionine incorporation.2 * * * NSP 3A NSP Relative invasion index (GFP/mRFP) * * 3A NSP Figure S5 continued 3

14 Figure S6 Working model for the role of scaffold protein PAK in the regulation of the PDK pathway. PAK activates via two mechanisms: membrane recruitment of and complex formation between PDK and. These scaffolding functions of PAK may regulate the efficiency, localization and specificity of the PDK pathway, and account for the kinaseindependent role of PAK in cell motility regulation. 4

15 Fig. a FlagRac V2 V2 C4 N7 p (T38) Fig. b N Rac V2 DN (NSP) p (T38) 69 Control # Fig. c Control # Rac V2 sirna # PAK2 p (T38) p p 69 p 69 Fig. d DN (NSP) min p (T38) Control sirna#2 Fig. e PAK2 sirna# min p (T38) Fig. 2b LF KN CKN p (T38) WT KN CKN NSP Fig. 2c p (T38) S473A KN CKN NSP p (T38) p p p p p Figure S7 Complete scans of blots presented in the manuscript. 5

16 69 Fig. 3a IP : Myc KN CKN NSP GST Fig. 3b GST KN CKN N (ΔPH) Fig. 3c IP : min Membrane Cytosol Control sirna# Fig. 3d PAK2 sirna# min Fig. 3g ΔPH KN KN CKN NSP p (T38) 69 Myc () 69 GST Mem Fig. 3f Cyto CKN + + (ΔPH) p (ΔPH) ΔPH mδph NSP + Fig. 3h Membrane Cytosol ΔPH mδph ΔPH mδph NSP + + Fig. 4a IP : Myc KN CKN NSP GST Fig. 4b GST KN CKN N p (T38) Flag (PDK) PDK PDK p 69 βintegrin αtubulin Myc () 69 GST Myc () Figure S7 continued 6

17 control IgG Fig. 4c IP : PDK min C N KN KN PT PDK KN Fig. 4d IP : HA () Flag () PDK +PDGF Fig. 4e IP : PDK Control sirna# sirna# PAK min longer exposure PDK PDK longer exposure PDK Rac V2 KN Fig. 4f IP : Myc () Fig. 4g KN Rac V2 V2 C4 N7 p (T38) KN CKN NSP Fig. 5g p (T38) 2 KN CKN NSP p (T39) IP Control IgG 2 Fig. 5h p p p (S474) 2 Figure S7 continued 7

18 Supplementary Information Methods RNA interference To knock down and PAK2 in COS cells, we used Stealth sirna (Invitrogen, PakHSS7575; 5 UUUCUUCUUAGGAUCGCCCACACUC3 ) and PAK2 Stealth sirna (Invitrogen, Pak2HSS7578; 5 UAGUAAUCGAGCCCACUGUUCUGGC3 ) as a first set of sirnas (sirna#), and Stealth sirna (Invitrogen, PakHSS7577; 5 UUAGCUGCAGCAAUCAGUGGAGUGA3 ) and PAK2 Stealth sirna (Invitrogen, Pak2HSS7; 5 UAAUGAUCAGUUCCUUCUUUGGCUG3 ) as a second set of sirnas (sirna#2). Stealth RNAi Negative Control Medium GC #2 (Invitrogen, 252) and Stealth RNAi Negative Control Low GC (Invitrogen, 252) were used as negative controls. Transfection of sirna duplexes was performed using the Lipofectamine2 Reagent (Invitrogen). Cells were analyzed 3 d after transfection. Cell staining Cells were fixed with 4% formaldehyde for min at room temperature, permeabilized with.2% Triton X in phosphatebuffered saline (PBS) for min, and incubated with 2% fetal bovine serum (FBS) and 2% bovine serum albumin (BSA) in PBS for 3 min to block nonspecific antibody binding. The antibodies used in this study include antiphospho (Ser99, Ser24), antiphospho (Ser473), anti, anti2 and antiha.

19 Apoptosis Assay NIH 3T3 cells were transfected with either control vector, a plasmid encoding DN ( 3A ) or Myctagged DN ( NSP ) together with a plasmid encoding GFPHistone H2B for 8 h. Cells were serumstarved for 6 h and fixed with ethanol for 5 min at 4 C. The percentage of cells with pyknotic nucleus among GFPHistone H2B positive cells was determined. Measurement of bulk translation NIH 3T3 cells were transfected with either control vector, a plasmid encoding DN ( 3A ) or Myctagged DN ( NSP ) for 8 h. Cells were cultured for h in methioninefree medium, followed by incubation in medium containing µci/ml of [ S]methionine for h. Cell lysates were resolved by SDSPAGE and bulk translation was detected by autoradiography. Invasion Assay NIH 3T3 cell invasion was assayed in 24well Biocoat Matrigel invasion chambers (8 µm; Becton Dickinson) according to the manufacturer s protocol. Briefly, transfected cells ( 5 ) were plated in the upper compartment of the chamber. The bottom chamber contained 2 ng/ml PDGF as a chemoattractant. After 2 h incubation, cells that had migrated through the membrane were fixed with 4% fomaldehyde for min at room temperature. For quantification, GFP or mrfppositive cells that had migrated through the membrane were counted by fluorescence microscope. Data are expressed as the proportion of GFPpositive cells to mrfppositive cells. 2