Supplementary Materials for

Transcription

1 Supplementary Materials for Short RNA Duplexes Elicit RIG-I Mediated Apoptosis in a Cell Type and Length-Dependent Manner Osamu Ishibashi, Md. Moksed Ali, Shan-Shun Luo, Takashi Ohba, Hidetaka Katabuchi, Toshiyuki Takeshita, Toshihiro Takizawa* *To whom correspondence should be addressed. t-takizawa@nms.ac.jp Published 8 November 2011, Sci. Signal. 4, ra74 (2011) DOI: /scisignal The PDF file includes: Fig. S1. Pre-351 reduced the viability of KGN cells regardless of the transfection method used. Fig. S2. Sequences of mirs-125b, -351, and -125a-5p. Fig. S3. Dose-dependent effect of poly(i:c) on KGN cell viability. Fig. S4. Effects of pre-mirs on HL-60 cell viability. Fig. S5. Pre-351 induced apoptosis of GC1 cells. Fig. S6. Subcellular translocation of cytochrome c and NF-κB in KGN cells transfected with Pre-351. Fig. S7. Pre-351 reduced the viability of KGN cells in an IFN-independent manner. Fig. S8. MDA5 is not involved in Pre-351 induced apoptosis of KGN cells. Fig. S9. sirna-mediated knockdown of RIG-I in KGN cells. Fig. S10. The transcriptional induction of a representative ISG (MX1) by Pre-351 was mostly unaffected by knockdown of RIG-I. Fig. S11. Pretreatment of HeLa cells with IFN-β potentiated the ability of Pre-351 to enhance caspase-3 and caspase-7 activities. Fig. S12. Knockdown of RIG-I in HuCCT1 cells by sirna. Fig. S13. Pre-351 induced the phosphorylation of p38 in KGN cells. Fig. S14. PKRI- and RIG-I dependent Pre-351 induced phosphorylation of p38. Fig. S15. Basal abundance of RIG-I mrna in KGN and HeLa cells. Fig. S16. Schematic model of short dsrna induced apoptotic signaling mediated by PKR, RIG-I, and p38 MAPK. Table S1. Genes whose expression was increased (>50-fold) in KGN cells after transfection with Pre-351 as compared to their expression in cells transfected with Pre-Cont. Table S2. List of sirnas used in this study. Table S3. Primers used for real-time PCR analysis.

2 Fig. S1. Pre-351 reduced the viability of KGN cells regardless of the transfection method used. LF2000 and Dharmafect I exerted similar effects on the Pre-351-induced reduction in KGN cell viability after 24 hours. The values for the cells transfected with Pre-Cont are set at 1. The data are presented as the mean ± SD (n = 5 sets of KGN cells). **P < 0.01 as compared to the KGN cells treated with Pre-Cont.

3 Fig. S2. Sequences of mirs-125b, -351, and -125a-5p. The seed sequences common to mir-125b, mir-351, and mir-125a-5p are underlined.

4 Fig. S3. Dose-dependent effect of poly( I:C ) on KGN cell viability. The values for the nontreated KGN cells are set at 1. The data are presented as the mean ± SD (n = 3 sets of KGN cells) from representative experiments performed three times yielding consistent results. **P < 0.01 as compared to the KGN cells treated with Pre-Cont.

5 Fig. S4. Effects of pre-mirs on HL-60 cell viability. The indicated pre-mirs exerted little effect on cell viability. The values for the Pre-Cont-transfected cells are set at 1. The data are presented as the mean ± SD (n = 5 sets of HL-60 cells) from representative experiments performed twice. **P < 0.01 as compared to the cells treated with Pre-Cont.

6 Fig. S5. Pre-351-induced apoptosis of GC1 cells. Similar to KGN cells (Fig. 3A), apoptosis detection assays demonstrated that Pre-351, but not Pre-Cont, induced type I and type II DNase-mediated DNA fragmentation 24 hours after transfection. Data from a representative experiment performed twice independently yielding similar results are shown.

7 Fig. S6. Subcellular translocation of cytochrome c and NF-κB in KGN cells transfected with Pre-351. (A) Subcellular fractions from KGN cells transfected with Pre-Cont and Pre-351 were analyzed by Western blotting. The amount of cytochrome c in the cytosolic fraction of KGN cells was increased by transfection with Pre-351. Conversely, the amount of cytochrome c in the organelle fraction (which contains mitochondrial proteins) was decreased by the same treatment. Thus, cytochrome c was translocated from the mitochondria to the cytosol in response to transfection with Pre-351, suggesting the induction of mitochondria-mediated apoptosis by Pre-351. (B) Subcellular fractions from KGN cells transfected with Pre-Cont and Pre-351 were analyzed by Western blotting for the presence of NF-κB (p65). NF-κB (p65) translocated from the cytosol to nuclei in response to transfection with Pre-351, indicating activation of this protein. Representative data from experiments performed twice independently yielding similar results are shown.

8 Fig. S7. Pre-351 reduced the viability of KGN cells in an IFN-independent manner. (A) KGN cells were transfected with sirnas specific for IFNAR1 (siifnar1) or a negative control (sint21), and the abundance of IFNAR1 mrna after 48 hours was assessed by real-time PCR. An ~80% reduction in IFNAR1 mrna abundance was achieved by the sirna-mediated knockdown. The values for the sint21-transfected cells are set at 1. The data are presented as the mean ± SD (n = 3 sets of reactions) from representative experiments performed twice yielding consistent results. **P < 0.01 as compared to the KGN cells treated with Pre-Cont. (B) Pre-351 reduced the viability of KGN cells regardless of IFNAR1 knockdown. The values for the Pre-Cont-transfected cells are set at 1. The data are presented as the mean ± SD (n = 7 sets of KGN cells) from representative experiments performed twice yielding consistent results. NS, not significant.

9 Fig. S8. MDA5 is not involved in Pre-351-induced apoptosis of KGN cells. (A) Validation of the sirna for MDA5 (simda5). Pre-351-induced MDA5 expression was efficiently blocked by simda5 at the protein level. (B) simda5 has no effect on Pre-351-induced reduction of KGN cell viability. The data are presented as the mean ± SD (n = 7 sets of KGN cells) from representative experiments performed twice yielding consistent results. NS, not significant.

10 Fig. S9. sirna-mediated knockdown of RIG-I in KGN cells. The sirna-mediated knockdown of RIG-I blocked the production of RIG-I protein 48 hours after the transfection of KGN cells with Pre-351. Representative data from experiments performed three times independently yielding similar results are shown.

11 Fig. S10. The transcriptional induction of a representative ISG (MX1) by Pre-351 was mostly unaffected by knockdown of RIG-I. The data are presented as the mean ± SD (n = 3 sets of reactions) from representative experiments performed twice yielding consistent results. **P < 0.01 as compared to the KGN cells treated with Pre-Cont.

12 Fig. S11. Pretreatment of HeLa cells with IFN-β potentiated the ability of Pre-351 to enhance caspase-3 and caspase-7 activities. The values for the nontreated cells are set at 1. The data are presented as the mean ± SD (n = 5 sets of HeLa cells) from representative experiments performed twice yielding consistent results. **P < 0.01.

13 Fig. S12. Knockdown of RIG-I in HuCCT1 cells by sirna. Western blotting analysis revealed that the IFN-β-induced increase in RIG-I protein abundance was suppressed by an sirna specific for RIG-I (sirig-i). Representative data from experiments performed three times independently yielding similar results are shown.

14 Fig. S13. Pre-351 induced the phosphorylation of p38 in KGN cells. The abundance of phosphorylated p38 in KGN cells was substantially increased after 12 hours, but returned to the basal amounts 24 hours after transfection with Pre-351. Representative data from experiments performed twice independently yielding similar results are shown.

15 Fig. S14. PKRI- and RIG-I-dependent Pre-351-induced phosphorylation of p38. Knockdown of (A) PKRI or (B) RIG-I suppressed Pre-351-induced phosphorylation of p38 as assessed by Western blotting analysis. Fold-increases in the band intensities of pp38 versus total p38 are shown. The data are presented as the mean ± SD (n = 3 experiments). **P < 0.01; *P < 0.05.

16 Fig. S15. Basal abundance of RIG-I mrna in KGN and HeLa cells. Real-time RT-PCR analysis revealed ~38-fold higher amounts of RIG-I mrna in KGN cells than in HeLa cells. The values for the amount of RIG-I mrna in HeLa cells are set at 1. The data are presented as the mean ± SD (n = 3 sets of reactions) from representative experiments performed twice yielding consistent results. **P < 0.01 as compared to HeLa cells.

17 Fig. S16. Schematic model of short dsrna induced apoptotic signaling mediated by PKR, RIG-I, and p38 MAPK.

18 Table S1. Genes whose expression was increased (>50-fold) in KGN cells after transfection with Pre-351 as compared to their expression in cells transfected with Pre-Cont. Gene symbol Accession No. Fold change OASL NM IFIT1 NM BST2 NM ISG20 NM IFIT2 NM MX1 NM MX2 NM C1orf38 BC BATF2 NM OAS2 NM IFIT3 NM TNFSF10 NM C1orf38 NM ISG15 NM IFITM1 NM IFI6 NM HRASLS2 NM IFIH1 NM TNFSF13B NM SSTR2 NM DDX58 NM HERC5 NM LMO2 NM CYP2J2 NM IFI44L NM IRF7 NM USP18 NM AW AW

19 Table S2. List of sirnas used in this study. Series sirna name Sense strand (5-3 ) Antisense strand (5-3 ) Length (nt) 1 sigfp21 cgacguaaacggccacaaguu cuuguggccguuuacgucgcc 21 sigfp22 cgacguaaacggccacaaguuc acuuguggccguuuacgucgcc 22 sigfp23 cgacguaaacggccacaaguucu aacuuguggccguuuacgucgcc 23 sigfp24 cgacguaaacggccacaaguucuc gaacuuguggccguuuacgucgcc 24 2 sint21 uucuccgaacgugucacgutt acgugacacguucggagaatt 21 sint22-1 uuucuccgaacgugucacgutt acgugacacguucggagaaatt 22 sint23-1 auucuccgaacgugucacgutt acgugacacguucggagaaautt 23 sint24-1 cauucuccgaacgugucacgutt acgugacacguucggagaaaugtt 24 3 sint21 uucuccgaacgugucacgutt acgugacacguucggagaatt 21 sint22-2 ccuguaucggacaaccaaggtt ccuugguuguccgauacaggtt 22 sint23-2 uccuguaucggacaaccaaggtt ccuugguuguccgauacaggatt 23 sint24-2 cuccuguaucggacaaccaaggtt ccuugguuguccgauacaggagtt 24 - siblunt27 aagcugacccugaaguucaucugcacc ggugcagaugaacuucagggucagcuu 27 - sirig-i ggaagaggugcaguauauutt aauauacugcaccucuucctt 21 - sipkr cauuggcaaaacuugaucatt ugaucaaguuuugccaaugtt 21 - siifnar1 gagucugucgggaaugugauu ucacauucccgacagacucuu 21 - simda5 gaauaacccaucacuaauatt uauuagugauggguuauuctt 21 *Nucleotides shown by upper cases indicate those of 3 -overhangs.

20 Table S3. Primers used for real-time PCR analysis. Gene Forward primer (5` to 3`) Reverse primer (5` to 3`) Length (bp) MX1 CTGTAAATCTCTGCCCCTGTTAG TCGTGTCGGAGTCTGGTAAAC 225 OASL GGACCGTGGAGGAGTTTCTG GAGCCCACCTTGACTACCTTC 94 RIG-I ATCCCAGTGTATGAACAGCAG GCCTGTAACTCTATACCCATGTC 72 PKR TGGAGTGCAATGACACAGTCTTG GTTGGGTGGGTGGCACAT 115 GAPDH GCACCGTCAAGGCTGAGAAC ATGGTGGTGAAGACGCCAGT 142 IFNAs GTGAGGAAATACTTCCAAAGAATCAC* TCTCATGATTTCTGCTCTGACAA* 93 IFNB1 CAGCAATTTTCAGTGTCAGAAGC TCATCCTGTCCTTGAGGCAGT 74 *These primers are designed to amplify multiple IFNA subtypes, such as IFNA2, IFNA4, IFNA7, IFNA8, IFNA10, and IFNA17.