Influence of Temperature on MBBR Denitrification for Advanced Nitrogen Removal of Wastewater Treatment Plant Effluent

Transcription

1 Influence of Temperature on MBBR Denitrification for Advanced Nitrogen Removal of Wastewater Treatment Plant Effluent Haiyan Wang K. Liu,Q.Y. Hang, Q. Yuan, M.J. Ma, and C. M. Li Research Center for Water Pollution Control Technology Chinese Research Academy of Enviromental Sciences Tel: ,

2 Outline Background Objective Materials and Methods Results and Disscussion Conclusions

3 1 BACKGROUND

4 Advanced nitrogen removal is necessary for the WWTP effluent reuse 1 2 Water shortage has becoming a serious problem The amount of municipal wastewater treatment plant (WWTP) effluent was large( ton/year) WWTP effluent is a good resource as reclaimed water. 80.8±8.4% NO 3- -N TN 15mg/L? 1.5mg/L 3 Discharge Standard of Pollutants for Municipal Wastewater Treatment Plant (GB ) IV recharge water for water sources, natural wetlands or rivers Environmental Quality Standards for Surface Water (GB )

5 Moving Bed Biofilm Reactor Actived Sludge Influent Effluent Bioflim MBBR Aeration/ Mixing Denitrification MBBR reported for sewage wastewater (Aspegren et al., 1998; Mases et al. 2010), nitrate contaminated seawater(labelle, et al., 2005) and landfill leachate (Cortez et al., 2011) nitrogen removal with good denitrification effficiency.

6 Denitrifiction MBBR could be used for WWTP effluent reuse The full scale MBBRs had also been applied since 1997 & 1999 for post denitrification in Sjölunda and Klagshamn WWTPs of Malmö City, Sweden, and the effluent TN could met the WWTP limitation (Mases et al. 2010). Carriers types Influencing factors hydraulic retention time (HRT) temperature the ratio of carbon to total nitrogen(c/n) mixing speed

7 2 OBJECTIVE

8 Objective The denitrification MBBR has been developed for WWTP effluent advanced nitrogen removal, and the influencing of carriers types, hydraulic retention time (HRT) and C/N ratio on its efficiency have been studied extensively in our published studies (Yuan et al. 2015; 2016). Temperature influence Variation obviously in different seasons in North China WWTPs built outside denitrification efficiency Microorganisms HOW the denitrificans community change?

9 Denitrification functional Genes Nar Nir Nor Nos narg nirs norb nosz NO 3 - NO 2 - NO N 2 O N 2 napa nirk norz Nap Cu Nir qnor qpcr molecular approach

10 3 MATERAIALS AND METHODS

11 Equipments and carriers Table1 Influent ingredients and operation conditions Polyethylene carriers with 25 mm diameter, 10 mm height, 0.96~0.98 g/l density and 620 m 2 /m 3 specific surface area. MBBR : 6.0 L volume and 5.7 L effective volume Influent : Secondary sedimentation tank effluent of Beijing Yongfeng WWTP C/N ratio: methanol addition to adjust C/N ratio to 8 HRT 12h Time(d) Temperature( ) CODCr(mg/L) TN(mg/L) NO 3 N(mg/L) Phase I(1 49d) ± ± ±2.6 PhaseII(50 98d) ± ± ±2.6 PhaseIII(99 147d) ± ± ±2.1 PE PhaseIV( d) ± ± ±2.1

12 Sequencing batch test in one HRT MBBR : 2.5 L volume and 2.0 L effective volume Influent : Secondary sedimentation tank effluent of Beijing Yongfeng WWTP Carriers filling rate: 30% C/N ratio: methanol addition to adjust C/N ratio to 8 HRT: 12h Sampling once every hour for 8 times in one HRT Time(d) Temperature( ) CODCr(mg/L) TN(mg/L) NO 3 N(mg/L)

13 Water Quality Index Detection Analytical methods TN :TN unit of TOC V CPH analyzer NO 3 N and NO 2 : Ion chromatography (Dionex ICS 1000 NH 4+ N :Nessler's reagent spectrophotometry method COD :COD speedy testing ph :S 25 ph Analyzer DOM analysis Three dimensional excitation emission matrix (EEM) fluorescence spectrophotometer Excitation source was used for the spectrometer, both excitation (Ex) and emission (Em) were nm with 5 nm bandwidth, and the scanning speed was nm min 1.

14 Analytical methods DNA extraction and qpcr analysis DNA extraction: UltraClean DNA extraction kit Two step Q PCR amplification procedure: 95 for 10 min; 40 cycles of 95 for 15 s, 60 for 1 min. Primers References NarG F 5 TA(CT)GT(GC)GGGCAGGA(AG)AAA 3 Smith et al., 2015 NarG R 5 CGTAGAAGAAGCTGGTGCTGTT 3 NirS F 5 GTSAACGTSAAGGARACSGG 3 Kandeler et al., 2006 NirS R 5 GASTTCGGRTGSGTCTTGA 3 NosZ F 5 CG(C/T)TGTTC(A/C)TCGACAGCCAG 3 Mao et al., 2011 NosZ R 5 G(G/C)ACCTT(G/C)TTGCC(C/G)T(T/C)GCG 3 Biomass analysis and SEM observation Biomass: SS weight method (Liu, 1992) SEM:HITACHI S 570 SEM

15 4 RESULTS AND DISCUSSION

16 Influence of temperature on Nitrogen Removal Influence of temperature on NO 3 N Removal NO - 3 -N(mg/L) 20 13( ) 19( ) 25( ) 30( ) Time( d ) Influent Effluent Removal rate -N removal rate(%) NO - 3 Temper ature( ) NO 3 N(mg/L) NO 3 N removal (%) NO 3 Nremoval rate (mg NO 3 N (L d) 1 ) ± ±26.7 %, 4.8± ± ±27.2 % 4.2± ± ±22.3 % 3.9± ± ±13.3% 4.0±2.1 The NO 3- -N removal and denitrification rate changed little with the temperature variation, and it indicated the temperature has little effect on the nitrate removal at 12h HRT, which might be because the long HRT (12h) of the MBBR could compensate for the low denitrification rate at low temperature.

17 Influence of temperature on Nitrogen Removal Influence of temperature on NO 3 N Removal in sequencing batch tests NO - 3 -N/(mg/L) ( ) 15( ) 20( ) 25( ) 30( ) Time(h) Tempe rature( ) Time for complete NO 3 N removal (h) The denitrification Rate(mg/L h) With the long HRT(12h), the microorganisms at low temperature could arrive the same removal efficiency as that of the high temperature for the time compensation (Zinatizadeh & Ghaytooli, 2015). The batch tests also explained why the similar nitrate removal were obtained at long HRT (12h ) at 13, 19, 25 and 30.

18 Influence of temperature on the Removal of Nitrogen in Other Form Temper atu re ( ) Influence of temperature on Nitrogen Removal NH 4+ N NO 2 N TN Influent (mg/l) Effluent (mg/l) Removal Influent (mg/l) Effluent (mg/l) Removal Influent (mg/l) Effluent (mg/l) Removal ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±2 3.9 The low NH 4+ -N and NO 2- -N varied little with the temperature, and they were not influenced obviously by the temperature in the batch tests. TN were also not affected by temperature obviously.

19 Influence of temperature on Organic Removal COD removal The COD Cr removal were 53.3±44.9%, 52.5±30.6%, 65.5±18.6% and 63.8±19.5%, which indicated that the temperature had little effect on the COD removal In batch tests, the CODcr removal were steady after 5h operation, and the COD Cr removal rate increased gradually with the temperatures of 10, 15, 20, 25 and 30.

20 Influence of temperature on Organic Removal DOM removal Peak I and II: tryptophan-like substances Peak III: the visible fulvic acid-like substance Peak IV: the UV fulvic acid-like substance Inffluent Effluent Effluent Effluent Effluent The total fluorescence intensity removal were 47.6%, 49.0%, 50.5% and 52.5% respectively

21 Microbiology characteristics at different temperature Biomass analysis and SEM observation Temperature( ) Bioma (mg/g) ss Bacilliform, filiform and spheroidal form Temperature had little influence on the carriers surface morphology, which consisted with the biomass analysis.

22 Microbiology characteristics at different temperature Temperature( ) narg gene (copies/g SS) nirs gene (copies/g SS) nosz gene (copies/g SS) The content of narg, nirs and nosz genes at 13 and 19 conditions were higher than those under 25 and 30. The highest abundance of narg, nirs and nosz genes, i.e , and copies/g-ss, were achieved at 13, 19 and 13 respectively, which were consistent with the long 12h HRT compensation.

23 5 CONCLUSIONS

24 CONCLUSIONS 1. The NO 3- -N removal and denitrification rate were not influenced by the temperature of 13, 19, 25 and 30 at 12h HRT for polyethylene MBBR, the NO 3- -N removal rate were 82.9±26.7 %, 80.1±27.2 %, 85.0±22.3 % and 82.9±13.3%. The long HRT of 12h may compensate for the denitrification ability of low temperature, which resulted the similar nitrate removal and denitrification rate at different temperatures. 2. The effluent COD could meet the Class IV limitation of Environmental Quality Standards for Surface Water (GB ). Three-dimensional fluorescence spectra showed that both of the MBBR influent and effluent contained DOM, such as fulvic acid-like and tryptophan-like substance, etc., and the total fluorescence intensity removal were 47.6%, 49.0%, 50.5% and 52.5%, respectively, at different temperatures.

25 3. The abundance of narg, nirs and nosz gene at 13 and 19 conditions were higher than those under 25 and 30. The highest abundance of narg and nosz genes, i.e and copies/g-ss were achieved at 13, which were consistent with the long 12h HRT compensation. The abundance of narg nitratereducing gene and nirs nitrite-reducing gene were both greater than that of nosz nitrous oxide reducing gene. 4. Considering the nitrogen, organic pollutants removal efficiency and denitrification genes abundance as a whole, 25 was the optimum temperature for nitrogen removal of WWTP effluent by denitrification MBBR.

26 Acknowledgements National Major Science and Technology Program for Water Pollution Control and Treatment (2014ZX )

27 THANK YOU FOR YOUR ATTENTION