NEXTflex PCR-Free Barcodes - 6 (For Illumina Platforms) Catalog # (Kit contains 48 reactions) Bioo Scientific Corp V12.

Transcription

1 NEXTflex PCR-Free Barcodes - 6 (For Illumina Platforms) Catalog # (Kit contains 48 reactions) Bioo Scientific Corp V12.10

2 This product is for research use only. Not for use in diagnostic procedures. This manual is proprietary to Bioo Scientific Corp., and intended only for customer use in connection with the product(s) described herein and for no other purpose. This document and its contents shall not be used or distributed for any other purpose without the prior written consent of Bioo Scientific. Follow the protocol included with the kit. Bioo Scientific, NEXTflex, NextPrep, NextPrep-Mag, AIR, The NGS Experts, qrna, Amplicon Studio, and NanoQ are trademarks or registered trademarks of Bioo Scientific. All other brands and names contained herein are the property of their respective owners.

3 NEXTflex PCR-Free Barcodes GENERAL INFORMATION 2 Product Overview 2 Contents, Storage and Shelf Life 2 Warnings and Precautions 2 NEXTflex PCR-FREE DNA SAMPLE PREPARATION PROTOCOL 3 NEXTflex PCR-Free DNA Sample Preparation Flow Chart 3 APPENDIX A 4 Oligonucleotide Sequences 4 Low Level Multiplexing 4 RELATED PRODUCTS 5 NOTES 8 THE NGS EXPERTS 1

4 GENERAL INFORMATION Product Overview The NEXTflex PCR-Free Barcodes are designed to prepare multiplexed single and pairedend genomic DNA libraries for sequencing using Illumina platforms. The index and flow cell binding sequence are designed within the NEXTflex PCR-Free Barcodes and are attached onto the sample insert during adapter ligation. Pooling with NEXTflex PCR-Free Barcodes allows the user to multiplex several samples in a single flow cell. Contents, Storage and Shelf Life The NEXTflex PCR-Free DNA Barcodes contain 6 barcoded DNA Adapters with enough material for 8 reactions each, for a total of 48 reactions. The shelf life of each reagent is 12 months when stored at -20 C. Kit Contents *The NEXTflex PCR-Free Barcode Adapters are supplied in duplex form. Do not heat the adapter above room temperature. Warnings and Precautions Amount NEXTflex PCR-Free Barcode Adapter 1-6* (50 µm) 20 µl Bioo Scientific strongly recommends that you read the following warnings and precautions. Periodically, optimizations and revisions are made to the components and manual. Therefore, it is important to follow the protocol included with the kit. If you need further assistance, you may contact your local distributor or Bioo Scientific at nextgen@biooscientific.com. Do not use the kit past the expiration date. Ensure pipettes are properly calibrated as library preparations are highly sensitive to pipetting error. Do not heat the PCR-Free DNA-Seq Barcoded Adapters above room temperature. Try to maintain a laboratory temperature of 20º 25ºC (68º 77ºF). Briefly spin down each component to ensure material has not lodged in the cap or side of tube. Keep on ice and vortex each component just prior to use. If performing PCR amplification, NEXTflex Primer Mix must be used during PCR amplification. Inadvertent use of an incorrect primer sequence can potentially result in elimination of the index. NEXTflex Primer Mix is available separately as a custom item. To request a quote, please contact your local distributor or Bioo Scientific at nextgen@biooscientific.com 2

5 NEXTflex PCR-FREE DNA SAMPLE PREPARATION PROTOCOL NEXTflex PCR-Free DNA Sample Preparation Flow Chart Figure 1: Sample flow chart with approximate times necessary for each step. GENOMIC DNA FRAGMENT = N = A = T = Adapters with Cluster Sequence END-REPAIR 30 Minutes (Optional Stop Point) SIZE SELECTION 1 Hour ADD A 30 Minutes ADD ADAPTERS LIGATION 15 Minutes (Optional Stop Point) BEAD CLEANUP BRIDGE AMPLIFICATION (CLUSTER GENERATION) THE NGS EXPERTS 3

6 APPENDIX A Oligonucleotide Sequences NEXTflex SEQUENCE (5 3 ) NEXTflex PCR-Free Barcoded Adapter AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT GATCGGAAGAGCACACGTCTGAACTCCAGTCACXXXXXX 1 ATCTCGTATGCCGTCTTCTGCTTG 1 XXXXXX denotes the index region of adapter. The index sequences contained in each adapter are listed below. NEXTflex DNA-Seq Index Barcode Adapter 1 CGATGT Barcode Adapter 2 TGACCA Barcode Adapter 3 ACAGTG Barcode Adapter 4 GCCAAT Barcode Adapter 5 CAGATC Barcode Adapter 6 CTTGTA Barcode Adapter 7 ATCACG Barcode Adapter 8 TTAGGC Barcode Adapter 9 ACTTGA Barcode Adapter 10 GATCAG Barcode Adapter 11 TAGCTT Barcode Adapter 12 GGCTAC Barcode Adapter 13 AGTCAA Barcode Adapter 14 AGTTCC Barcode Adapter 15 ATGTCA Barcode Adapter 16 CCGTCC Barcode Adapter 17 GTAGAG Barcode Adapter 18 GTCCGC Barcode Adapter 19 GTGAAA Barcode Adapter 20 GTGGCC Barcode Adapter 21 GTTTCG Barcode Adapter 22 CGTACG Barcode Adapter 23 GAGTGG Barcode Adapter 24 GGTAGC NEXTflex DNA-Seq Index Barcode Adapter 25 Barcode Adapter 26 Barcode Adapter 27 Barcode Adapter 28 Barcode Adapter 29 Barcode Adapter 30 Barcode Adapter 31 Barcode Adapter 32 Barcode Adapter 33 Barcode Adapter 34 Barcode Adapter 35 Barcode Adapter 36 Barcode Adapter 37 Barcode Adapter 38 Barcode Adapter 39 Barcode Adapter 40 Barcode Adapter 41 Barcode Adapter 42 Barcode Adapter 43 Barcode Adapter 44 Barcode Adapter 45 Barcode Adapter 46 Barcode Adapter 47 Barcode Adapter 48 ACTGAT ATGAGC ATTCCT CAAAAG CAACTA CACCGG CACGAT CACTCA CAGGCG CATGGC CATTTT CCAACA CGGAAT CTAGCT CTATAC CTCAGA GCGCTA TAATCG TACAGC TATAAT TCATTC TCCCGA TCGAAG TCGGCA Low Level Multiplexing 2 barcodes: (4, 6) or (3, 19) 3 barcodes: (4, 6, and any other barcode) / (3, 19, and any other barcode) / (1, 5, 19) or (3, 12, 15) or other 3 barcode combinations (many combinations are possible) 4 barcodes: (4, 6, and two other barcodes) / (3, 19, and two barcode) / (3, 4, 6, 19) / (1, 2, 5, 16) or other 4 barcode combinations (many combinations are possible) 4

7 RELATED PRODUCTS Illumina Compatible RNA NGS Kits and Adapters Catalog # Product NEXTflex Rapid RNA-Seq Kit (8 reactions) NEXTflex Rapid RNA-Seq Kit (48 reactions) NEXTflex Rapid Directional RNA-Seq Kit (8 reactions) NEXTflex Rapid Directional RNA-Seq Kit (48 reactions) NEXTflex RNA-Seq Barcodes NEXTflex RNA-Seq Barcodes NEXTflex RNA-Seq Barcodes NEXTflex RNA-Seq Barcodes NEXTflex-96 RNA-Seq Barcodes NEXTflex qrna-seq Kit 4 barcodes (8 reactions) NEXTflex qrna-seq Kit 24 barcodes - Set A (48 reactions) NEXTflex qrna-seq Kit 24 barcodes - Set B (48 reactions) NEXTflex qrna-seq Kit 24 barcodes - Set C (48 reactions) NEXTflex qrna-seq Kit 24 barcodes - Set D (48 reactions) D NEXTflex Rapid Directional qrna-seq Kit 4 barcodes (8 reactions) D NEXTflex Rapid Directional qrna-seq Kit 24 barcodes - Set A (48 reactions) D NEXTflex Rapid Directional qrna-seq Kit 24 barcodes - Set B (48 reactions) D NEXTflex Rapid Directional qrna-seq Kit 24 barcodes - Set C (48 reactions) D NEXTflex Rapid Directional qrna-seq Kit 24 barcodes - Set D (48 reactions) NEXTflex Small RNA Sequencing Kit (24 reactions) NEXTflex Small RNA Sequencing Kit (48 reactions) NEXTflex Small RNA Sequencing Kit v2 (24 reactions) NEXTflex Small RNA Sequencing Kit v2 (48 reactions) NEXTlfex Small RNA Barcode Primers -12 (Set A) NEXTlfex Small RNA Barcode Primers -12 (Set B) NEXTlfex Small RNA Barcode Primers -12 (Set C) NEXTlfex Small RNA Barcode Primers -12 (Set D) NEXTflex Poly(A) Beads (8 reactions) NEXTflex Poly(A) Beads (48 reactions) NEXTflex Poly(A) Beads (100 reactions) THE NGS EXPERTS 5

8 Illumina Compatible DNA NGS Kits and Adapters Catalog # Product NEXTflex 16S V4 Amplicon-Seq Kit NEXTflex 16S V4 Amplicon-Seq kit NEXTflex 16S V4 Amplicon-Seq kit NEXTflex 16S V4 Amplicon-Seq kit NEXTflex 16S V4 Amplicon-Seq kit NEXTflex 16S V4 Amplicon-Seq kit NEXTflex 16S V4 Amplicon-Seq kit NEXTlfex 16S V1-V3 Amplicon-Seq Kit NEXTlfex 16S V1-V3 Amplicon-Seq Kit NEXTlfex 16S V1-V3 Amplicon-Seq Kit NEXTlfex 16S V1-V3 Amplicon-Seq Kit NEXTlfex 16S V1-V3 Amplicon-Seq Kit NEXTlfex 16S V1-V3 Amplicon-Seq Kit NEXTlfex 16S V1-V3 Amplicon-Seq Kit NEXTflex DNA Sequencing Kit (8 reactions) NEXTflex DNA Sequencing Kit (48 reactions) NEXTflex Rapid DNA-Seq Kit (8 reactions) NEXTflex Rapid DNA-Seq Kit (48 reactions) NEXTflex Cell Free DNA-Seq Kit (8 reactions) NEXTflex Cell Free DNA-Seq Kit (48 reactions) NEXTflex DNA Barcodes NEXTflex DNA Barcodes NEXTflex DNA Barcodes NEXTflex DNA Barcodes NEXTflex-96 DNA Barcodes (Plate Format) NEXTflex-96 DNA Barcodes (Tube Format) NEXTflex Dual-Indexed DNA Barcodes (1-96) NEXTflex Dual-Indexed DNA Barcodes (97-192) NEXTflex Bisulfite-Seq kit (8 reactions) NEXTflex Bisulfite-Seq kit (48 reactions) NEXTflex Bisulfite-Seq Barcodes NEXTflex Bisulfite-Seq Barcodes NEXTflex Bisulfite-Seq Barcodes NEXTflex Methyl-Seq 1 Kit (8 reactions) NEXTflex Methyl-Seq 1 Kit (48 reactions) 6

9 NEXTflex Msp 1 (8 reactions) NEXTflex Msp 1 (48 reactions) NEXTflex ChIP-Seq Kit (8 reactions) NEXTflex ChIP-Seq Kit (48 reactions) NEXTflex ChIP-Seq Barcodes NEXTflex ChIP-Seq Barcodes NEXTflex ChIP-Seq Barcodes NEXTflex ChIP-Seq Barcodes NEXTflex-96 ChIP-Seq Barcodes NEXTflex Pre-Capture Combo Kit (6 barcodes) NEXTflex Pre-Capture Combo Kit (12 barcodes) NEXTflex Pre-Capture Combo Kit (24 barcodes) NEXTflex Pre-Capture Combo Kit (48 barcodes) NEXTflex Pre-Capture Combo Kit (96 barcodes) NEXTflex DNA Barcode Blockers - 6 for SeqCap NEXTflex DNA Barcode Blockers - 12 for SeqCap NEXTflex DNA Barcode Blockers - 24 for SeqCap NEXTflex DNA Barcode Blockers - 48 for SeqCap NEXTflex DNA Barcode Blockers - 96 for SeqCap NEXTflex PCR-Free DNA Sequencing Kit (8 reactions) NEXTflex PCR-Free DNA Sequencing Kit (48 reactions) NEXTflex PCR-Free Barcodes NEXTflex PCR-Free Barcodes NEXTflex PCR-Free Barcodes NEXTflex PCR-Free Barcodes 48 DNA Fragmentation Catalog # Product AIR DNA Fragmentation Kit (10 reactions) AIR DNA Fragmentation Kit (40 reactions) THE NGS EXPERTS 7

10 NOTES 8

11 WE WANT TO HEAR FROM YOU! Your feedback is important to us. Tell us what you think of our kits by scanning the QR code or visiting our website at We can t wait to hear from you!

12 THE NGS EXPERTS Bioo Scientific Corporation 7050 Burleson Road, Austin, Texas BiooScientific.com P: F: Bioo Research Products Group Made in the USA