Rothamsted Research where knowledge grows Editing Plant Genomes: Potential for Crop Improvement Prof. Huw D Jones PhD FSB Dept. Plant Biology & Crop Science Rothamsted Research UK EFSA GMO Panel member since 2009 Honorary Professor, School of Bioscience, Nottingham University 3 rd Plant Genomics Congress London May 2015
Crops have unusually large and complex genomes Size (Mb) Chrom. Ploidy Genes E. coli 4 1 N/A 4,377 Arabidopsis 135 5 diploid 27,000 Rice 390 12 diploid 37,544 Maize 2300 10 diploid 32,540 Wheat 17000 21 hexaploid 94,000
Cell Technologies To fully exploit the advances in sequencing & bioinformatics for crops Also need parallel advances in technologies for genetic and cellular engineering: Robust methods for genetic transformation Libraries of promoters to predictably control gene expression Tools for targeting /tagging recombinant proteins Ability to edit genes in planta Evidence-/Risk-based and transparent Regulatory Framework
Wheat Transformation >1000 events /yr Identification & optimisation of key variables Explant Variety Preculture Size, Gene Transformation Optimised methods for DNA-delivery using Gene Gun or Agro strain & vectors Tissue culture ph co-cultivation & regeneration protocols Acetosyringone Surfactant: Basal media Type Hormones / Concentration Dark / light Temp / timing Amoah, Wu, Sparks & Jones (2001) J Exp Bot 52: 1135-1142 Wu, Sparks, Amoah & Jones (2003) Plant Cell Rep 21: 659-668 HD Jones, A Doherty and H Wu (2005). Plant Methods 1:5. Wu, Doherty & Jones (2007) Transgenic Res 17(3): 425-436. Freeman, Sparks, West, Shewry Jones (2011). P. Biotech J 9: 788 796 Zhang, Jones, Gao, Wang, Ma, Xia (2013). BMC Genomics 14:560
Regulation of gene expression Mapped over 40 Constitutive, Tissue-specific or Inducible promoters in wheat UidA / GUS DsRed GFP YC3.6 Yellow Chameleon Anthocyanin GFP
Mapping expression patters of gene switches (promoters) Maize globulin 1 in bread wheat Sparks et al in preparation AGPL1 (Adenosine diphosphate glucose pyrophosphate large subunit) in bread wheat Wheat globulin 1 in bread wheat Chrimes D, et al (2005). NewPhytologist, Vol 166 (1): 185-192. 1Dx5 HMWGS (-1141 +57) ::GUS in durum wheat Sparks et al in preparation Pina::GUS in bread wheat Lamacchia et al. (2001). Journal of Experimental Botany 52:243-250. Wiley, et al. (2007). Plant Molecular Biology, 64: 125-136.
Seed promoter 1 Seed promoter2 Seed promoter 3 Seed promoter 4 Andy Phillips / Simon Vaughan / Alison Huttly
Heat-shock promoter (Hvhsp17)::GUS Leaf in 40 C water bath Same organ from transformed plant no heat shock + 40 C heat shock Acknowledgements: Marko Jääskeläinen, Nikolay Belevich, Alan Schulman University of Helsinki and MTT Agrifood Res. Finland Freeman, Sparks, Shewry & Jones (2011). Plant Biotechnology Journal 9: 788 796
Targeting trans-proteins using transit peptides GFP in wheat guard cell chloroplasts GFP wheat lines validating transit peptides from : Wheat SSU RubisCO, Rice FtsZ Maize ferredoxin III Maize histone H2B developing amyloplasts in wheat endosperm Eg. GFP-targeting to Plastids and Nuclei GFP targeted to wheat leaf nuclei LF Primavesi, H Wu, EA Mudd, A Day and HD Jones (2008) Transgenic Research 17(4): 529-543
Amyloplasts in Wheat pollen Bright field image GFP fluorescence No targeting sequence 10 μm Uniform distribution of GFP Plus targeting sequences 10 μm Starch grains highlighted LF Primavesi, H Wu, EA Mudd, A Day and HD Jones (2008) Transgenic Research 17(4): 529-543
Genome editing: Suite of technologies to make targeted changes to genomes Site-Directed Nucleases Meganucleases Zinc-Finger Nuclease (ZFN) Transcription activator-like effector nucleases (TALENs) Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR CAS-9) Oligonucleotide Directed Mutagenesis (ODM) DNA/RNA Chimeraplasty Rapid Trait Development System RTDS (Cibus) Gene Repair Oligonucleotide (GRON)
Site-directed nucleases (ZFN, TALEN, Crispr, MNs) Publications Shan et al 2013 TALEN CRISPR-CAS ZFN 500 400 300 200 100 0 '05 '06 '07 '08 '09 '10 '11 '12 '13 '14 Year
Site-directed nucleases (SDN) for gene editing Fig 1. A pair of TALEN proteins each composed of a DNA-binding domain and a Fok1 nuclease designed to make a double stranded break in a pre-determined genetic locus. (From Open Resource for TAL effectors) T G C T A T C C A G T A G C G A T G G A C T T A G G A A G C T G A G T T C C G A A T... A C G A T A G G T C A T C G C T A C C T G A A T C C T T C G A C T C A A G G C T T A...
DNA repair generates heritable sequence changes Wilen CB, et al. (2011) Engineering HIV-Resistant Human CD4+ T Cells with CXCR4-Specific Zinc-Finger Nucleases. PLoS Pathog 7(4): e1002020.
BBSRC T&R grant (Edwards & Jones). Development of specific TALENs for precision engineering in wheat
Analysis of T0 transgenic wheat Spo11 edited using Cas9 nuclease. 1 2 3 4 5 6 7 8 9 10 11 12 1314 15 16 17 18 19 20 21 22 23 C MW ATGTACCCCTCCATGTTCGT S0 S3 S10 S14 AAGAGGGACATCTACTACATGTACCCCTCCATGTTCGTAGGTCTGT AAGAGGGACATCTACTACATGTA...TCGTAGGTCTGT AAGAGGGACATCTACTACA...GTAGGTCTGT AAGAGGGACATCTACTACATGT...TCGTAGGTCTGT Genomic DNA from T0 plants were digested with RsaI followed by PCR amplification using primers flanking the target site. DNA fragments resistant to further RsaI digestion in lines 3 (S3), 10 (S10) and 14 (S14) along with non-digested PCR fragment from nontransgenic DNA (S0) were subjected to sequence analysis In collaboration with Prof Keith Edwards
Mildew resistance by editing all 6 mlo alleles in wheat Mildew-resistance only when all 6 alleles were KO Wang Y. et al. (2014) Simultaneous editing of three homoeoalleles in hexaploid bread wheat confers heritable resistance to powdery mildew. Nat. Biotech. 32 947 951
Gene Repair OligoNucleotide (GRON) technology FOR IMMEDIATE RELEASE Cibus Global Announces Approval of First Commercial Product SU Canola in Canada San Diego (March 18, 2014) Cibus Global, a cutting-edge precision gene editing firm, announced today that its first commercial product Sulfonylurea Tolerant Canola has received Plant Novel Trait approval by the Canadian Food Inspection Agency. About Cibus Global Cibus Global is a leading precision gene editing company with a unique, patented technology for naturally modifying cell functions. Its technology enables access to global multibilliondollar markets in agriculture, specialty chemicals, and human health. It offers a disruptive alternative to transgenic (GM or GMO) approaches. Our core purpose is to lead the transition to sustainable agricultural and industrial products and improved human health by safely harnessing Nature s own genetic diversity.
SU HT Canola non-gm in US
Intense activity from Risk Assessors & Regulators
Regulation of herbicide Tolerant crop varieties in EU Huw Jones (2015) Challenging regulations: Managing risks in crop biotechnology. In Press.
Acknowledgements (all Rothamsted Research unless indicated) Genome editing Transformation, promoters & tags Keith Edwards (Bristol Uni.) Lanqin Xia (ICS, CAAS, Beijing) Caroline Sparks Andy Phillips Alison Huttly Caroline Sparks Many Riley Angela Doherty Jackie Freeman Alison Huttly