Po Leung Kuk Laws Foundation College

Similar documents
Transcription:

Po Leung Kuk Laws Foundation College Hong Kong, China A preliminary investigation of genetic sequence of adult Chinese horseshoe crab, Tachypleus tridentatus, collected from fishermen in Hong Kong Li M.H., Lee C.H., Cheung H.M., Ho T.K., Lam H.Y., Leung C.H., Ong Y.C., Tan Y.L., Lam Y.H., Tam H.Y

Introduction Found abundant on shore in Hong Kong by local villagers in the 1950s. Horseshoe crab population is decreasing T. tridentatus were purchased from local fishermen and restaurants in Hong Kong We aim at studying the genetic connectivity of T. tridentatus within Hong Kong

Methodology DNA analysis of T. tridentatus and C. rotundicauda 10 individuals from 9th December to 1st February Sampling Blood extraction Genomic DNA Extraction PCR Gel Electrophoresis DNA Sequencing

Blood Sampling - Direct puncture through dorsal cardiac membrane - 1 ml Hemolymph Hemocytes - Stored in sterilized 1.5 ml eppendorf under -20 ºC Horseshoe crabs purchased by our teammates from Sai Kung Pier Two of our teammates were extracting blood samples by direct cardiac puncture

Genomic DNA extraction - DNeasy blood and tissue kit (QIAGEN, U.S.) - DNA concentration and purity was checked using nano drop Spectrophotometer and 1 % agarose gel electrophoresis

PCR The mt AT-rich region (approximate size: 650 bp) was amplified using the following primers: Hb-12S Sequence (5-3 ): GTCTAACCGCGGTAGCTGGCAC & Hb-trna Sequence (5-3 ): GAGCCCAATAGCTTA-AATTAGCTTA (Lavrov et al. 2000, Yang et al. 2007). SapphireAMP fast PCR master mix and Bio-Rad PCR machine were used 35 cycles

Gel Electrophoresis - 1 % agarose gel &120 V - 20 minutes Sybr Safe DNA Gel Stain (Life Technologies) was used for visualizing the PCR products under UV transilluminator

DNA Sequencing The PCR products were sent to the Institute of Marine Biology, National Taiwan Ocean University for sequencing. Result - Common haplotypes - 7 T. tridentatus were likely originated from the same area

Discussion T. tridentatus available in Hong Kong are most likely come from the south-eastern shore in China. They may origionate from the same region A further investigation is needed (Ming Che Yan) (Ming Che Yan)

Questionnaire-Format Three Versions- Same question but in different language Chinese For Hong Kong citizens (including students, employees, professionals, etc.) English For Hong Kong citizens (Mainly for professionals) Japanese For Japanese (All)

Question covered Public Awareness Education 1. Do you know what is a Horseshoe Crab? 12. Do you think Horseshoe Crab should be under conservation? 2. How do you know Horseshoe Crab? 3a. Which of the following types of horseshoe crab you have heard of? 3b. Do you know which of the following types of Horseshoe Crabs will present in Hong Kong's territorial waters? 13. Which of the following can be the most effective way to convey the message of ''Conservation of Horseshoe Crab''? 4. Do you know the use of Horseshoe Crab? 14. Which of the following is/are the reason(s) why you do not think Horseshoe Crab should under conservation? 5. Which of the following place(s)that people can find Horseshoe Crab in Hong Kong? 15. Would you like to know more about Horseshoe Crabs in the following days?

Public Awareness 6. Do you know which of the followings are the living conditions of Horseshoe Crab? 7. Do you know the way of growth and development of Horseshoe Crab? 8. May I ask what is/are the reason(s) why you may not know what is Horseshoe Crab? 11. Which of the following are/is the reason(s) why you may not realize the risks Horseshoe crabs are facing? 9. Do you know Horseshoe crabs are facing threats of survival? 10. Do you know what kinds of threats are they facing?

Results (Data generates from 12 May to 23 May Chinese Version-Total respondents:107) (Data generates from 15 June-Japanese version-total respondents:43) Question Chinese Version Japanese Version Key 1. Do you know what Horseshoe Crabs are? People who know what Horseshoe Crab is. People who don t know what Horseshoe Crab is. 9.Do you know Horseshoe crabs are facing threats of survival? Yes No

Question Chinese / Japanese Version key 3a. Which of the following types of horseshoe crab you have heard of? Chinese Version Tachypleus tridentatus Carcinoscorpoius rotundicauda Tachypleus gigas Limulus polyphemus People who do not know any types of Horseshoe Crab N/A Japanese Version N/A Carcinoscorpoius rotundicauda Tachypleus gigas Limulus polyphemus Tachypleus tridentatus People who do not know any types of Horseshoe Crab

Question Chinese / Japanese Version key 4.Do you know the use of horseshoe crab? Chinese Version Japanese Version From up to down (respectively) 1.can be used as medicine 2.can be cooked 3.can be used for medical test

Reflection: Public Awareness (Comparing these two cities(sasebo and Hong Kong)) The respondents(hong Kong) barely understand what Horseshoe crabs are The awareness towards extinction species are quite low What can we do to raise the awareness of the general public in Hong Kong?

Question Chinese / Japanese Version Key 13. Which of the following can be the most effective way to convey the message of Conservation of Horseshoe Crab? Chinese Version Japanese Version Organizing workshops Reducing the use of Horseshoe Crab for cooking Maintain high quality of water in Hong Kong Organize different programmes to secondary or primary school students (Such as: The Juvenile Horseshoe Crab Rearing programme--co-organized by OPHKCF and City University) Other

Reflection: Education Hong Kong people think that education is more important Janpanese think that conservation in the environment is more important Education can be a way to raise public awareness Can the topic of Conservation of Horseshoe Crabs imply to the Hong Kong s teaching materials?

Inspiration & Insights In campus we can: Utilize our knowledge to hold small sharing sessions or making Horseshoe Crab information boards Raise the awareness on protecting the horseshoe crabs Transmit message through social media After joining this program: We understand the importance of conserving the Horseshoe crabs We should prevent over-hunting and avoid eating We should change our attitude towards Horseshoe crabs

Inspiration & Insights Being a university student: Carry out some research about horseshoe crabs in bigger scale Get more accurate results to understand their migration trends

Inspiration & Insights Being a university student: Carry out some research about horseshoe crabs in bigger scale Get more accurate results to understand their migration trends

Acknowledgment This investigation is supported by technical assistance from Dr. Alice Chan and advice from Dr. Paul Shin, Department of Biology and Chemistry, City University of Hong Kong

Thank you