J. Phycol. 42, 1142 1154 (2006) r 2006 by the Phycological Society of America DOI: 10.1111/j.1529-8817.2006.00268.x USING QUANTITATIVE PCR TO DETERMINE THE DISTRIBUTION OF A SEMICRYPTIC BENTHIC DIATOM, NAVICULA PHYLLEPTA (BACILLARIOPHYCEAE) 1 Véronique Créach 2, Anneliese Ernst Netherlands Institute of Ecology, (NIOO-KNAW), PO Box 140, 4400 AC, Yerseke, The Netherlands Koen Sabbe, Bart Vanelslander, Wim Vyverman Laboratory of Protistology & Aquatic Ecology, Department of Biology, Ghent University, Krijgslaan 281-S8, B-9000 Ghent, Belgium and Lucas J. Stal Netherlands Institute of Ecology, (NIOO-KNAW), PO Box 140, 4400 AC, Yerseke, The Netherlands Evidence has accumulated during the last decade showing that many established diatom morpho-species actually consist of several semicryptic or truly cryptic species. As these species are difficult or even impossible to differentiate by microscopic analysis, there is virtually no information on how they behave in natural environments. In this study, we developed a quantitative real-time PCR (qpcr) assay using TaqMan probes s targeted to the internal transcribed spacer 1 (ITS1) to assess the spatial distribution and seasonal dynamics of an important component of the microphytobenthos of intertidal sediments. Navicula phyllepta Kützing is a brackishmarine morpho-species with a cosmopolitan distribution. Axenic clones of this species were isolated from natural assemblages of benthic diatoms at different intertidal stations in the Westerschelde estuary (The Netherlands). At least two distinct semicryptic species of N. phyllepta were present, as shown by differences in the quantity of DNA per cell, the ITS1 sequences and the copy number of ITS per cell. DNA and chl a concentrations extracted from sediment surface samples were closely correlated, showing that the DNA used for subsequent analysis mostly belonged to the microalgal community. The results of real-time qpcr from sites throughout the estuary and over several seasons agreed well with microscopic counts. Additionally, the seasonal pattern of the two forms of N. phyllepta showed an overlapping, but unique distribution along the estuary. Key index words: diatoms; estuary; Navicula phyllepta; niche differentiation; real-time qpcr; semicryptic species 1 Received 23 November 2005. Accepted 3 July 2006. 2 Author for correspondence and present address: Center for Environment, Fisheries and Aquaculture Science (Cefas), Pakefield Road, Lowestoft, Suffolk NR33 0HT, UK. e-mail v.creach@cefas.co.uk. Benthic diatoms are one of the most important groups of photoautotrophic microorganisms in estuarine intertidal sediments where they play a major role in ecosystem functioning (Underwood and Kromkamp 1999). Several investigations have shown that benthic diatoms are an essential component of the food web of intertidal mudflats (Middelburg et al. 2000) as well as of the water column after re-suspension (Lucas et al. 2000). Many benthic diatom taxa are well adapted to fluctuating environmental conditions (Admiraal et al. 1984, Colijn and de Jonge 1984), which might explain their cosmopolitan distribution (Round 2004). The growth rate and the rates of carbon fixation of benthic diatoms can equal those of pelagic species (Barranguet and Kromkamp 2000, Brandini et al. 2001). The presence of benthic biofilms may control the rate of nutrient exchange between the sediment and the water column (Sündback et al. 2000). Moreover, biofilms of benthic diatoms have been shown to contribute to the stabilization of estuarine sediment surfaces by causing an increase of the erosion threshold (Tolhurst et al. 2003). Biofilms of microphytobenthos in intertidal mudflats of the Westerschelde estuary (the Netherlands) are generally dominated by raphid, motile pennate diatoms (epipelic diatoms) (Muylaert et al. 2002, Forster et al. 2006). These diatoms have been shown to belong to a monophyletic group of organisms (Medlin and Kaczmarska 2004, Sorhannus 2004) that appeared in the middle of the Eocene about 55 million years ago (Medlin et al. 1993). The majority of the epipelic diatoms in temperate intertidal mudflats belong to the order of Naviculales (Montani et al. 2003, Haubois et al. 2005). The microscopic identification of Navicula species is cumbersome because of the morphological plasticity inherent to their life cycle and because some characteristics can only be discerned by scanning electron microscopy (Cox 1997, 1998, Mann 1999). The morpho-species Navicula phyllepta Kützing is often a key species in intertidal mudflats. It can reach 60% 75% of the biomass of the total microphytobenthic community 1142
DISTRIBUTION OF NAVICULA IN ESTUARY 1143 (Thornton et al. 2002, Haubois et al. 2005). N. phyllepta has a widespread distribution, suggesting adaptation across a range of environmental conditions such as salinity, emersion time, and temperature (Krammer and Lange-Bertalot 1986, Witkowski et al. 2000, Lange-Bertalot 2001, Sabbe et al. 2003). Ribosomal genes are frequently used for phylogenetic reconstructions. The nuclear ribosomal operon of diatoms has the structure 18S rdna ITS1 5.8S rdna ITS2 28S rdna (Zechman et al. 1994) and may be present in multiple copies (Armbrust et al. 2004). While both 18S and 28S rrna genes have been used for the reconstruction of the phylogeny of diatoms, the ITS region, comprising ITS1 5.8S rrna gene ITS2 has been proven to be useful for molecular analyses at the species level or beyond. Additionally, ITS has been used to resolve intra- and interspecific relationships of a variety of eukaryotes, including diatoms (Zechman et al. 1994, Behnke et al. 2004, Orsini et al. 2004), and the phylogenetic relationships between populations and their biogeographical repartition (Bakker et al. 1992, Kooistra et al. 1992). The broad ecological range of N. phyllepta suggests that this species complex may be composed of more than one taxon. Sequence analysis of the ITS from a variety of isolated strains demonstrated that the morpho-species N. phyllepta actually consists of two well-separated clusters which can be regarded as semicryptic taxa as they show subtle but stable morphological differences such as size, difference in valves width and stria density (B. Vanelslander et al. unpublished data). In this study, a real-time quantitative PCR (real-time qpcr) assay using primers targeting part of the ITS1 region and Taqman s probes was developed in order to measure the abundance of the two semicryptic forms of N. phyllepta along the salinity gradient in the Westerschelde estuary. We determined their distinct spatial and seasonal distribution patterns along the estuary and compared the results with microscopic counts. Real-time qpcr has been applied in environmental studies to quantify the number of copies of a specific gene and to estimate the number of cells of a particular microorganism containing the targeted gene. It had been also used to quantify the number of transcripts of the target gene as a measure of the potential metabolic activity coded by that specific gene by using reverse transcriptase PCR in an initial step. These approaches have been successfully used in ecological studies on diatoms (Leblanc et al. 1999, Wawrik et al. 2002, Wei et al. 2004), dinoflagellates (Bowers et al. 2000, Galluzzi et al. 2004), cyanobacteria (Becker et al. 2000, Suzuki et al. 2000), and bacteria (Labrenz et al. 2004, Skovhus et al. 2004). Quantitative PCR offers all the advantages of conventional PCR, such as high sensitivity (Becker et al. 2002, Newby et al. 2003), reproducibility, and specificity. MATERIALS AND METHODS Sampling sites and diatom isolation. Microphytobenthic biomass and biodiversity were measured on several occasions at three intertidal locations, Appelzak (A), Biezelingsche Ham (B), and Paulina Polder (P), from oligohaline to polyhaline conditions in the Westerschelde estuary, The Netherlands (Fig. 1). At each location, high-shore (A 1,B 1,P 1 ) and midshore (A 2,B 2,P 2 ) stations were selected on the exposed mudflats. Shore heights of the stations relative to lowest and highest tidal levels were determined by reference to a digital elevation model of the estuary, and confirmed by direct observation of the timing of emersion and immersion periods. FIG. 1. Location of the study sites in the Westerschelde estuary (The Netherlands). Each site had two stations: high shore A 1 (51 00 23 0 01N; 004 00 14 0 32E), B 1 (51 00 26 0 40N; 003 00 55 0 28E) and P 1 (51 00 20 0 59N; 003 00 43 0 51E), and middle shore A 2 (51 00 23 0 00N; 004 00 14 0 19E), B 2 (51 00 26 0 36N; 003 00 55 0 43E), and P 2 (51 00 21 0 07N; 003 00 43 0 45E).
1144 V. CRÉACH ET AL. TABLE 1. Characteristics of the sampling stations on the Westerschelde estuary (The Netherlands). Stations Water content (%) Organic matter (%) Median grain size (mm) Salinity Emersion time (h per 24 h) Chl a (mg m 2 ) Applezak A 1 65.7 (18.1) 2.6 (1.6) 55.8 (58.7) 9 (5) 14.1 20.2 25.8 290.4 A 2 57.3 (11.9) 2.3 (1.2) 42 (8.9) 10.4 (5.2) 9.8 14.1 11.6 292.1 Biezelingsche Ham B 1 65.4 (8.6) 2.3 (0.6) 26.2 (3.6) 21.1 (3.8) 13.6 15.3 19.6 183.6 B 2 52.1 (7.2) 1.4 (0.6) 45.5 (16.9) 21.3 (5.4) 10.9 12.6 4 126.5 Paulina Polder P 1 23.3 (1.8) 0.4 (0.3) 218.1 (24.5) 23.7 (4) 12.2 17.6 18.4 229.2 P 2 43.5 (8.6) 0.8 (0.5) 56.7 (22.4) 24.1 (4.3) 9.8 13.9 4.7 163.9 The means and SD in brackets were calculated from nine samples. Chl a was measured by HPLC after acetone extraction. Characteristics of the sites are listed in Table 1. Each station was sampled nine times between April 2002 and September 2003. In 2002, diatoms were isolated from all six stations. Biofilm samples were suspended in seawater from the same location and this suspension was subsequently spread on 1.5% agarose plates (Bacto Agar, Brunschwig Chemie, Germany) amended with F/2 growth medium (Guillard and Ryther 1962). After 2 4 weeks of incubation at 171 C at a 14:10 light:dark (L:D) cycle (light source Cool White 36W compact fluorescent tubes, Philips, The Netherlands) at 80 120 mmol photons m 2 s 1, individual colonies were picked and sub-cultivated on agarose plates as well as in liquid medium (f/2 growth medium). Dilution-plating and picking of colonies were repeated until axenic cultures were obtained (Table 2). This was checked by microscopic examination, and by the absence of bacterial growth on agarose plates amended with Bacto yeast extract and peptone. Microscopy. The species composition in the microphytobenthos of the Westerschelde was determined from surface sediment samples (upper 2 mm, 18 cm 2 ), removed with a contact corer (Ford and Honeywill 2002). At each station, within an area of approximately 25 m 2, five samples were taken and pooled. In order to visualize the ultrastructural features of the siliceous cell walls, aliquots of samples from each site were oxidized with a 1:1 mixture of hydrogen peroxide (30%) and acetic acid (100%). The oxidized material was mounted in Naphrax (PhycoTech, St. Joseph, MI, USA). Approximately 300 diatom valves (range, 277 336) were identified and counts were made by using a Leitz Diaplan microscope equipped with Differential Interference Contrast. Cultivated diatoms were identified as described above. For quantitative extraction of DNA, cells of three cultures of two isolates of N. phyllepta (CCY 0222 and CCY 0212) were enumerated in a Bürker chamber. From each culture, four aliquots TABLE 2. Origin and taxonomic designation of strains and corresponding GenBank accession numbers of the sequences used. Taxon Isolates Culture collection site Origin Isolation date GenBank accession number Navicula phyllepta Cluster 1 CCY 0218 NIOO-CEME Biezelingsche Ham, April 2002 DQ193558 Westerschelde estuary CCY 0221 NIOO-CEME Appelzak, Westerschelde estuary April 2002 DQ193555 CCY 0222* NIOO-CEME Appelzak, Westerschelde estuary April 2002 DQ193556, DQ193557 CCY 0230 NIOO-CEME Appelzak, Westerschelde estuary September 2002 DQ193570 CO-04-01 Dept.Biol., Univ. Essex Colne River January 2004 DQ193571 Cluster 2 CCY 9804* NIOO-CEME Ems-Dollard estuary April 1998 DQ193551 CCY 0201* NIOO-CEME Biezelingsche Ham, January 2002 DQ193546 Westerschelde estuary CCY 0212* NIOO-CEME Paulina polder, Westerschelde estuary April 2002 DQ193543, DQ193544 CCY 0213* NIOO-CEME Paulina polder, Westerschelde estuary April 2002 DQ193547 CCY 0226* NIOO-CEME Appelzak, Westerschelde estuary September 2002 DQ193550 CCY 0227 NIOO-CEME Paulina polder, Westeschelde estuary September 2002 DQ235783 Navicula arenaria CCY 0228* NIOO-CEME Paulina polder, Westschelde estuary September 2002 DQ235781 PS2-F1 Lab. Prot., Univ. Gent Paulina polder, Westschelde estuary June 2003 DQ235782 Navicula gregaria B1-8 Lab. Prot., Univ. Ghent Biezelingsche Ham, June 2003 DQ235778 Westerschelde estuary IIB1-37 Lab. Prot., Univ. Ghent Biezelingsche Ham, June 2003 DQ235779 Westerschelde estuary IIP1-49 Lab. Prot., Univ. Ghent Paulina polder, Westerschelde estuary June 2003 DQ235780 CCY, culture collection Yerseke (NIOO-CEME, Yerseke, The Netherlands); The strains with an * are available upon request.
DISTRIBUTION OF NAVICULA IN ESTUARY 1145 TABLE 3. List of primers and probes used for the real-time qpcr assays. Clusters Sequences (5 0! 3 0 ) T m (1 C) Cluster 1 (CCY 0222) Primers DITS142F TGGCCTCCTATCTTTGGG 56 DITS1127R* AATACTGGGTTTGGCGTTT 52.4 Probe ITS1R* TCGCAAGTGAGCTTGGCAGC 63.8 Cluster 2 (CCY 0212) Primers DITS15F CACACCTTYGATCCAAGATCAAT 58 DITS1113R* CGTTTCAGATTCGCAGCA 52.4 Probe ITS1F CCCGTGAACYTGGCCTCCTATC 62.7 Specific primers or probes are specified by an *. were counted four times and the average number of cells per milliliter were calculated. Chlorophyll a and DNA extraction. From the same stations as described above, five individual surface sediment samples (upper 2 mm, 18 cm 2 ) were removed with a contact corer. The samples were immediately frozen in liquid nitrogen, freeze-dried in the dark and stored at 801 C until the analysis. Algal biomass was estimated from measurement of chl a. Pigments were extracted with 90% acetone from aliquots of 100 mg of freeze-dried sediment. Mechanical disruption using 1 mm beads in a Bead Beater for 20 s ensured the efficient release of pigments. Chlorophyll a was quantified from the acetone extracts by using HPLC following the procedure described in Rijstenbil (2003) and expressed as the chl content per dry weight of sediment (mg chla g 1 dry weight). Two samples were selected for each station for DNA extraction from the freeze-dried contact cores. Nucleic acids were extracted from approximately 100 to 200 mg dry sediment using the UltraCleant Soil DNA Kit (MoBio Laboratories, Solana Beach, CA, USA). An extra elution step was added to the manufacturer s instruction to ensure quantitative removal of DNA from the purification columns (final volume 200 ml). The quality of the nucleic acid was evaluated on a 1% agarose gel (Sigma), run in 1 TAE buffer and stained by SYBR Gold (Molecular Probes, Leiden, Zwijndrecht, The Netherlands). DNA was quantified with the PicoGreen dsdna quantification Kit (Molecular Probes) using a microplate reader (Fluostar Galaxy, BMG Labtechnologies, Offenburg, Germany). A similar procedure was used to extract and quantify DNA content from N. phyllepta strain CCY 0222 and strain CCY 0212. Cells of three cultures of each strain were counted (see above), and two aliquots (2 and 4 ml of strain CCY 0222 and 1 and 2 ml of strain CCY 0212) of each culture were harvested by centrifugation (5000g for 10 min). DNA was extracted and quantified as described above. PCR Primers, TaqMan s probes, and real-time qpcr assays. TheentireITSregionwasamplifiedusingtheforward primer in the end of the 18S rdna (5 0 -GGAAGGT- GAAGTCGTAACAAGG-3 0 ) and reverse primer in the beginning of the 28S rdna (5 0 -CTNGTTAGTTTCTTTTCCT- CCG-3 0 ). The 1021 1084 bp PCR products of ITS were cloned in PCR II-TOPO vector TA cloning kit (Invitrogen, Breda, The Netherlands) according to the manufacturer s instructions. Vector primers (T7 forward and T3 reverse) were used as sequencing primers. Sequences were obtained using the ABI 3100 prism s BigDye s Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Nieuwerkerk, The Netherlands). The ITS1 sequences of isolated diatoms (accession numbers see Table 2) were aligned using ClustalX (Thompson et al. 1997). Priming sites and target sequences of the probes specific for the two phylogenetic clusters of N. phyllepta were identified by comparison with sequences of other Navicula species (Table 2). Primers and probes (Table 3) were designed using the program Primer Premier 5 (Premier Biosoft Int., Palo Alto, CA, USA) and the services of Tib-Molbiol (Berlin, Germany). TaqMan s probes were 5 0 -labeled with the fluorescent dye FAMt and 3 0 -labeled with the quencher TAMRAt (Tib-Molbiol). Real-time qpcr assays were performed with the Lightcycler s (Roche Diagnostics, Almere, The Netherlands) using the Lightcycler FastStart DNA Master plus Hybridization Probes and the Lightcycler FastStart DNA SYBR Green I (Roche Diagnostics). The kits were supplemented with our custom primers (final concentration, 0.5 mm each) and probes (final concentration, 0.2 mm each) and contained 5 ml of DNA in a final volume of 20 ml. The PCR program comprised an initial 10 min denaturation step at 951 C and 40 cycles consisting of a 15 s denaturation step at 951 C and a 1 min annealing/polymerization step either at 601 C (cluster 1) or 631 C (cluster 2) for both assay format, respectively. The two steps were connected by heating and cooling speeds of 101 and 201 C/s, respectively. Finally, the PCR products were cooled down to 401 C. Each PCR run included a standard curve, established with a serial dilution of linear plasmids from cloned target sequences, ITS1, representative for cluster 1 (strain CCY 0222) or cluster 2 (strain CCY 0212), respectively. Controls without templates (H 2 O) and with non-target DNA (10 5 copies of the plasmid with the insert from the other cluster) were also included. Quantification of the amount of target DNA in sediment samples was accomplished by measuring the threshold cycle (C T, Heid et al. 1996) and using the standard curve to determine the starting copy number. The entire process of calculating C T s, preparing a standard curve, and determining starting copy number for unknown samples was performed by the software of the Lightcycler Software version 3.5 (Roche Molecular Biochemicals, Indianapolis, IN, USA). RESULTS Efficiency of the DNA extraction from sediments and its relationship with chl a. The efficiency of DNA extraction from mudflat sediments was tested with five freeze-dried contact cores collected at different sampling sites in the Westerschelde. The samples were chosen according to their silt content (minimum 5%, maximum 87%) and median grain size (21 220 mm). Three to four DNA extractions were processed from each sample using from 20 to 200 mg of dry sediment. In all cases, DNA recovery was proportional to the quantity of sediment treated. The correlation coefficients were slightly higher in sediments containing 50% 70% of sand (r 2 5 0.99, P<0.001, n 5 6) than
1146 V. CRÉACH ET AL. FIG. 2. Relationship between DNA and chl a extracted from sediment (r 2 5 0.78, n 5 95, P<0.001). Samples A 1,A 2,B 1,B 2 for April and May 2002 2003 and March 2003 ( ), samples A 1,A 2, B 1,B 2 for October 2002 2003 and all the sampling dates for P 1 and P 2 (~). in muddy sediments containing at least 70% of silt and clay (r 2 5 0.94, P<0.001, n 5 14). As a measure for the biomass of the microphytobenthos, we determined the chl a content of freeze-dried contact cores collected at the sampling sites during the nine sampling campaigns between May 2002 and September 2003. The DNA and chl a content expressed on the basis of sediment dry weight varied between 2.8 and 80 ng g 1 dry wt and 1.4 850 mg g 1 dry wt, respectively. There was a positive correlation between the quantity of chl a and DNA contents extracted from the same sediment sample (r 2 5 0.78, P<0.001, n 5 95; Fig. 2). The variations in DNA and chl a contents depended on seasons and sediment characteristics. For both DNA and chl a the highest values were observed in spring and in muddy sediments. Specificity of the primers and efficiency of the real-time qpcr. Phylogenetic analysis of the 18S rrna gene and the intergenic transcribed spacer region between 18S and 28S rrna genes showed that N. phyllepta isolates from the Westerschelde formed two phylogenetic clusters (Fig. 3). The ITS1, which comprised 384 bp in cluster 1 and 441 448 bp in cluster 2, exhibited the highest sequence divergence (32%), including insertion/deletion mutations (indels; Fig. 4). The PCR-primers for specific detection of each cluster were designed so that each pair included one highly specific primer i.e. exhibiting at least 28% sequence divergence at the target position of the other cluster. Furthermore, they were selected for minimal tendency to form primer dimers. The PCR-primers selected for specific detection of genotypes assigned to clusters 1 and 2 produced 104 and 128 bp fragments of the ITS1, respectively. Specificity and efficiency of amplification was extensively tested using endpoint-pcr and real-time qpcr in two detection formats: SYBR-Green and TaqMan. The specificity of the qpcr was assayed using defined mixtures of FIG. 3. Maximum likehood (ML) tree for Internal Transcribed Spacer 1 (ITS1) showing the two clusters of Navicula phyllepta. Bootstrap proportion values (450%) for ML (100 replicates) are shown above nodes. Branch lengths are proportional to the amount of substitutions.
DISTRIBUTION OF NAVICULA IN ESTUARY 1147 FIG. 4. Alignment of the ITS1 sequences of the two clusters of Navicula phyllepta. Strains CCY 0222 (DQ193556) and CCY 0212 (DQ193543) are in cluster 1 and cluster 2, respectively.
1148 V. CRÉACH ET AL. reference plasmids, containing the cloned ITS1 fragments of N. phyllepta strain CCY 0222 (cluster 1) and strain CCY 0212 (cluster 2), respectively. The results showed no cross reactivity of the primers with nontarget DNA. The two sets of primers were also applied to analyze the genomic DNA of Navicula strains isolated from the three locations in the Westerschelde as well as two reference strains from the Ems-Dollard estuary and the Colne River (see Table 2). An amplification product was only observed for strains that were identified as N. phyllepta. Moreover, in all strains tested only one set of PCR primers gave a positive result, and a fragment of the expected size, which allowed unequivocal assignment of all strains to either one of the clusters. For reliable quantification, the amplification efficiency during PCR must be equal for the recombinant DNA used in the calibration curves and the DNA extracted from the investigated samples, and, for high sensitivity, the amplification efficiency should approach 100%. In the exponential phase of the PCR, the number of amplicons (Y n ) produced after n PCR cycles is expressed as Y n ¼ N0 ð1 þ eþn ð1þ where e is the amplification efficiency of one PCR step (0 < e < 1). In calibration curves performed with recombinant DNA reference plasmids and genomic DNA of N. phyllepta strains CCY 0222 and CCY 0212, e was 1.08 0.08 (n 5 6, 0.13, 1), and 1.15 0.08 (n 5 6, 0.122, 1), respectively (in brackets, number of calibration curves, mean squared error, and regression coefficient). Because of this high efficiency, the fluorescent signal produced from 10 target sequences in a single TaqMan assay passed the threshold value within less than 35 cycles. Assays that exhibited lowered amplification efficiency were excluded from analyses. DNA content and number of ITS1 sequences per cell. We determined the DNA content and the number of ITS1 copies per cell in two isolates of N. phyllepta, CCY 0212 and CCY 0222. Cells were harvested 15 days after inoculation at concentrations of 7.4 8.2 10 5 and 1.5 2.3 10 6 cells ml 1, respectively. The mean DNA content per cell was 0.15 0.02 pg (n 5 11) for strain CCY 0212 and 0.04 0.008 pg (n 5 11) for strain CCY 0222. The DNA samples (n 5 22) were used to estimate the number of ITS1 copies per cell in real-time qpcr assays. The number of copies per cell calculated from the regression equation (Fig. 5) was 92 copies per cell for CCY 0212 and 144 copies per cell for CCY 0222. Quantification of the two N. phyllepta clusters in the Westerschelde estuary. The number of ITS1 sequences of each of the two ITS1 genotypes of N. phyllepta was determined by real-time qpcr in the DNA extracted from surface sediment samples, which were collected at three sites (six locations) along the salinity gradient of the Westerschelde estuary (Fig. 1). DNA extracted from a high-biomass sediment sample (samples with the highest chl a content) was analyzed twice and the FIG. 5. Number of copies as a function of DNA amount. The regression for the compiled data was fitted linearly as Copies 5 6 10 5 ( 1 10 5 )DNA(r 2 5 0.9, n 5 11, P<0.01) for CCY 212 and Copies 5 4 10 6 ( 1 10 6 ) DNA (r 2 5 0.84, n 5 11, P<0.001) CCY 0221, where Copies is the number of copies per microliter and DNA is expressed in ng DNA per microliter. average values are shown in Figure 5. Owing to the patchiness of microphytobenthos in the field, DNA from a second sediment sample collected from the same station at the same date was analyzed. Even if the numbers of cells per square meter were different due to different biomass, a similar trend for both sediment samples was observed (data not shown). The distribution of the two clusters differed significantly (Wilcoxon Matched pairs test, T 5 144, n 5 54, P<0.05) along the estuary (Fig. 6). When both genotypes were present, cluster 1 showed a higher number of copies per square meter than cluster 2 (2 600 times more) except in April and May 2002 in P 1 and April 2002 and 2003 in P 2 (Fig. 6, P 1,P 2 ). Assuming that the number of ITS sequence copies determined for strains CCY 0222 (144 copies) and CCY 0212 (92 copies) are representative for all genotypes assigned to the same cluster, the cell number in surface sediment samples was calculated. Cell numbers of cluster 1 genotype varied from 8.5 10 6 at station P 2 to 2.7 10 10 cells m 2 in station A 2. No sample was below the detection limit. The cell density was significantly higher in Appelzak than in the Biezelingsche Ham and Paulina Polder sediments, and in April 2002 compared with the other sampling dates (MANOVA, F (2, 107), (8, 107) 5 11.09 and 4.8, P<0.01). In contrast to cluster 1, the abundance of cluster 2 did not differ between sites (MANOVA, F (2, 107) 5 1.8, P 5 0.155). The cluster 2 genotype was not detected in February and September 2003 and reached maximum abundance of 3.9 10 9 cells m 2 in April 2002 at station P 1 (Fig. 6B). There was no significant difference between high and middle shore sampling sites whatever the cluster (MANOVA, F (1, 107) 5 0.15, P 5 0.15 for cluster1, F (1, 107) 5 2.78, P 5 0.098 for cluster 2).
DISTRIBUTION OF NAVICULA IN ESTUARY 1149 FIG. 6. Temporal and spatial distribution of the two clusters of Navicula phyllepta expressed by number of copies per square meter along the salinity gradient from oligohaline (A 1,A 2 ) to polyhaline (P 1,P 2 ) conditions in the Westerschelde estuary. Comparison of the number of cells calculated on basis of real-time qpcr and the relative abundance of N. phyllepta from microscope counts. Microscopic counting of the cleaned valves of epipelic diatoms showed a highest percentage of N. phyllepta in the microphytobenthos of Appelzak in May 2002: 24% and 37% at the sites A 1 and A 2, respectively. The percentages observed at the other locations (Biezelingsche Ham and Paulina Polder) varied between 0% and 10%, except in September 2002 when 19% of the valves counted at station P 1 were assigned to this species. As these values represent relative abundances within the total pool of diatoms, they were not directly comparable with cell densities derived from real-time qpcr. Using the average chl a per station and a cellular content of 5.3 pg of chl a per cell (De Jong and Admiraal 1984), we estimated the number of cells per square meter of N. phyllepta from the microscopic counts (Fig. 7). The values from the realtime qpcr and the microscopic counts were in the
1150 V. CRÉACH ET AL. FIG. 7. Comparison between the number of cells per square meter of Navicula phyllepta (cluster 1 þ cluster 2) determined by quantitative real-time PCR (full line) and microscopic counts (dashed line) for stations A 1,A 2, B 1,B 2,P 1, and P 2. same order of magnitude, 5 10 7 1.7 10 10 and 1.2 10 7 6 10 9 cells m 2, respectively. The population dynamic of N. phyllepta determined with the two methods showed a good agreement (r 2 5 0.24, P<0.01, n 5 48), particularly in Appelzak (Fig. 7, A1, A2). DISCUSSION Recent investigations have identified epipelic diatoms as key species in the relationship between biodiversity and ecosystem function in intertidal environments (Forster et al. 2006). However, assessing the biodiversity of microalgae is not a trivial task. Determination at the species level is only possible by taxonomic experts but even then, different genotypes may reveal the same phenotype and vice versa. Owing to these difficulties molecular genetic approaches are more informative for following the diversity and distribution of microalgal populations. In this study, real-time qpcr was used to determine the diversity and distribution of Navicula phyllepta, a key species in intertidal mudflats. The analysis of ITS sequences demonstrated that N. phyllepta is a semicryptic species that is divided in at least two clusters that are difficult to identify by microscopy (B. Vanelslander et al. unpublished). The abundances of the two forms of N. phyllepta were quantified in samples obtained from intertidal mudflats along a salinity gradient in the Westerschelde estuary. The results showed that the two forms have a different distribution. Form 1 (i.e. ITS1 cluster 1) was dominant at the brackish sites and showed a recurrent seasonal pattern with highest densities in late spring. Form 2 (i.e. ITS1 cluster 2) was generally less abundant, occurred mainly at higher salinities, and only bloomed
DISTRIBUTION OF NAVICULA IN ESTUARY 1151 during spring of the first sampling year. A difference of distribution patterns of N. phyllepta caused by different organic waste and nutrient concentrations has been already described in estuaries (Peletier 1996, Thornton et al. 2002) but never related to different forms of the species. Cryptic or semicryptic species such as N. phyllepta have been reported for several marine organisms (Knowlton 1993, Darling et al. 2004), which may or may not be sympatric. The presence of the two forms in the same environment suggests that they occupy different niches and thrive under different environmental conditions such as temperature and nutrients, sensitivity to pollutants, chemical composition, or light stress conditions (Mann 1999). The simultaneous presence of semicryptic species in the same environment can also be explained by their life cycle strategies and the control exerted by predators or parasites (Orsini et al. 2004). In order to investigate the relationships, many clones of each cluster have to be isolated and tested for their properties and behavior under various conditions (Gallagher 1982, Rynearson and Armbrust 2004). Clones of N. phyllepta belonging to the two clusters have indeed been shown to differ in their growth responses to salinity (B. Vanelslander et al. unpublished data) in the laboratory. These results confirm the distribution pattern relative to salinity of the two forms in the estuary. However a wider survey of parameters is necessary to obtain a complete overview of the ecology of the two forms. Trends in the distribution of N. phyllepta populations along the estuary analyzed by real-time qpcr have been compared with microscopic counting. In addition to being the only method available to enumerate organisms of cryptic species, this molecular technique is much faster compared to traditional taxonomic analyses and microscopic counting. It gives an accurate abundance of a certain genotype, which is not biased by an observer. In this study, the classic and molecular techniques gave rather similar results for the dynamic and the magnitude of N. phyllepta population. However, some discrepancies existed. The real-time qpcr showed a higher number of peaks for the population particularly at Biezelingsche Ham (B 2 ) and Paulina Polder (P 1, P 2 ). These discrepancies could be explained not only by the heterogeneity of the samples, but also by using an average of chl a content per cell to convert the relative to absolute count for the microscopic data which does not take into account the variability between different species or different individuals. A good agreement between data from real-time qpcr and other methods has been observed for picoeukaryotes, Chlorophyta, and Mamiellales (Zhu et al. 2005) and Alexandrium minutum (Galluzzi et al. 2004). However, the comparison was not successful for Aureococcus anophagefferens (Popels et al. 2003). Although quantitative real-time PCR is attractive due to its sensitivity, speed, and the possibility of automation, a number of assumptions need to be considered. The various protocols for extracting DNA from microorganisms in soils or sediments are often not satisfactory. The reasons for this are that some microorganisms are difficult to break or that extracellular polymeric substances interfere. Co-extraction of humic acids is another problem that interferes with the quality of the extracted DNA. In recent years, commercial extraction kits for different sample materials have been significantly improved and are increasingly used because of their constant quality and hence the possibility for comparisons between different laboratories. The variability in efficiency, reproducibility, phylotype abundance, and composition of the microbial community strongly depends on the DNA extraction method applied (Martin-Laurent et al. 2001, Mumy and Findlay 2004). The choice of the DNA extraction method is dependent on the type of soil, the characteristics of the sediment (Lipthay et al. 2004) or the type of microorganism under study (Frostegard et al. 1999). In the present study, the extracted DNA was of high quality and could be directly amplified and quantified. A dilution step to decrease humic acid concentration was not necessary. Hence, the quantity of DNA obtained was not the limiting factor and did not affect the sensitivity of the method. The correlations in this study between the amount of recovered DNA and the quantity of extracted sediment, and between DNA and chl a contents in the sample indicated a high reproducibility and DNA extraction efficiency. There is little known about DNA content per cell (DNA C-value) for diatoms and even less for marine benthic diatoms. It is also difficult to make any comparison with the values in the literature for other organisms (Vaulot et al. 1994, Veldhuis et al. 1997) as there is a 5000-fold range in DNA C-values in unicellular eukaryotic algae (see Table 1 in Cavalier-Smith 1978). The DNA content of N. phyllepta from form 2 was found to be in the same range as Navicula pelliculosa (Holm-Hansen 1969), whereas the DNA content per algal cell for form 1 was four times lower and appeared to be in the bottom end of the known values for algae (Cavalier-Smith 1978). However, the two forms of N. phyllepta followed the proportional relationship between cell size and DNA C-value observed for algae (Holm-Hansen 1969) and in eukaryotes in general (Gregory 2001). The division of the two forms of N. phyllepta was even more obvious in terms of numbers of copies of ITS1 in each cluster. The two forms differed from each other by 52 copies, but both were close to the regression line established in Zhu et al. (2005), which showed a positive relationship between rrna gene copy number and cell length. The range of copy numbers is wide in unicellular eukaryotic algae from 1 for Nannochloropsis salina (Zhu et al. 2005) to 1000 in Alexandrium minutum (Galluzzi et al. 2004). The two forms of N. phyllepta presented copy numbers of 92 and 144, which are close to that of another Bacillariophyte Nitszchia closterium (Zhu et al. 2005). However, environmental heterogeneity during periods of asexual division, sexual recombination, and random mutation can generate diversity in microalgal species. The variability in ITS1
1152 V. CRÉACH ET AL. between the clusters and even within the cluster can be high for N. phyllepta and as a result the total number of cells of this species may be underestimated by a less efficient detection of target sequence that exhibit a sequence variation in the target sequences of primers or the probe. The real-time qpcr assay for N. phyllepta has been developed on the basis of 13 cloned ITS sequences from 11 strains isolated and cultivated from the Westerschelde, one strain from the Ems-Dollard estuary (NL) and one strain from the River Colne (UK). Although this number of strains is limited, they still probably represent the dominant clones for N. phyllepta, being isolated during a period of 2 years and during bloom events where the chance to obtain the more abundant genotypes is high. It is difficult to evaluate the clonal variability in ITS1 because of sexual crossing events. In the last few years, the real-time qpcr appears to be a very powerful method to quantify organisms. It is a sensitive, specific and low time consuming technique for processing the analysis. However, the optimization of the assay can be laborious. For a species complex, one must take into account the number of clusters, their variability and the quantity of targeted gene for each cluster. This study showed two different clusters for N. phyllepta. They differed in DNA content and ITS gene copy number and sequences. The structure of the phylogenetic tree supports the conclusion that there is a potential interbreeding between the clones from the same cluster but not between the two clusters (Mann 1999, Behnke et al. 2004). Additionally, the real-time qpcr showed that their distribution differs along the estuary as well as their abundance. These new sets of data on N. phyllepta reinforces the idea (Thornton et al. 2002) that this key species for intertidal ecosystem should be revised, not only in term of genetic variations but also ecological preferences. We thank Marije Doeleman, Ute Wollenzien, and Dr. Victor Chepurnov for their technical assistance and Dr. Graham Underwood (University of Essex, UK) for providing a strain of Navicula phyllepta. We thank Dr. R. M. Forster for providing the data of chl a. This study was supported by the Research Council for Earth and Life Science (ALW) in the framework of the Flemish-Dutch collaboration on marine research (VLA- NEZO) subsidized by F.W.O. N.W.O.), contract ALW 832.11.003, and by BOF project GOA 01GZ0705 (Ghent University). This is Publication 3899 Netherlands Institute of Ecology (NIOO-KNAW). Admiraal, W., Peletier, H. & Brouwer, T. 1984. The seasonal succession patterns of diatom species on an intertidal Mudflat an experimental-analysis. Oikos 42:30 40. Armbrust, E. V., Berges, J. A., Bowler, C., Green, B. R., Martinez, D., Putnam, N. H., Zhou, S. G., Allen, A. E., Apt, K. E., Bechner, M., Brzezinski, M. A., Chaal, B. K., Chiovitti, A., Davis, A. K., Demarest, M. S., Detter, J. C., Glavina, T., Goodstein, D., Hadi, M. Z., Hellsten, U., Hildebrand, M., Jenkins, B. D., Jurka, J., Kapitonov, V. V., Kroger, N., Lau, W. W. Y., Lane, T. W., Larimer, F. W., Lippmeier, J. C., Lucas, S., Medina, M., Montsant, A., Obornik, M., Parker, M. S., Palenik, B., Pazour, G. J., Richardson, P. M., Rynearson, T. A., Saito, M. A., Schwartz, D. C., Thamatrakoln, K., Valentin, K., Vardi, A., Wilkerson, F. P. & Rokhsar, D. S. 2004. The genome of the diatom Thalassiosira pseudonana: ecology, evolution, and metabolism. Science 306:79 86. Bakker, F. T., Olsen, J. L., Stam, W. T. & Vandenhoek, C. 1992. Nuclear ribosomal DNA internal transcribed spacer regions (ITS1 and ITS2) define discrete biogeographic groups in Cladophora-albida (Chlorophyta). J. Phycol. 28:839 45. Barranguet, C. & Kromkamp, J. 2000. Estimating primary production rates from photosynthetic electron transport in estuarine microphytobenthos. Mar. Ecol. Prog. Ser. 204: 39 52. Becker, S., Böger, P., Oehlmann, R. & Ernst, A. 2000. PCR bias in ecological analysis: a case study for quantitative Taq nuclease assays in analyses of microbial communities. Appl. Environ. Microbiol. 66:4945 53. Becker, S., Fahrbach, M., Boger, P. & Ernst, A. 2002. Quantitative tracing, by Taq nuclease assays, of a Synechococcus ecotype in a highly diversified natural population. Appl. Environ. Microbiol. 68:4486 94. Behnke, A., Friedl, T., Chepurnov, V. A. & Mann, D. G. 2004. Reproductive compatibility and rdna sequence analyses in the Sellaphora pupula species complex (Bacillariophyta). J. Phycol. 40:193 208. Bowers, H. A., Tengs, T., Glasgow, H. B., Burkholder, J. M., Rublee, P. A. & Oldach, D. W. 2000. Development of real-time PCR assays for rapid detection of Pfiesteria piscicida and related dinoflagellates. Appl. Environ. Microbiol. 66:4641 8. Brandini, F. P., da Silva, E. T., Pellizzari, F. M., Fonseca, A. L. O. & Fernandes, L. F. 2001. Production and biomass accumulation of periphytic diatoms growing on glass slides during a 1-year cycle in a subtropical estuarine environment (Bay of Paranagua, Southern Brazil). Mar. Biol. 138:163 71. Cavalier-Smith, T. 1978. Nuclear volume control by nucleoskeletal DNA, selection for cell volume and cell growth rate, and the solution of the DNA C-value paradox. J. Cell Sci. 34: 247 78. Colijn, F. & de Jonge, V. N. 1984. Primary production of microphytobenthos in the Ems-Dollard estuary. Mar. Ecol. Prog. Ser. 14:185 96. Cox, E. J. 1997. Assessing and designating diatom taxa at or below the species level a consideration of current status and some suggested guidelines for the future. Nova Hedwigia 65:13 26. Cox, E. J. 1998. The identity and typification of some naviculoid diatoms (Bacillariophyta) from freshwater or brackish habitats. Phycologia 37:162 75. Darling, K. F., Kucera, M., Pudsey, C. J. & Wade, C. M. 2004. Molecular evidence links cryptic diversification in polar planktonic protists to Quaternary climate dynamics. Proc. Natl. Acad. Sci. 101:7657 62. De Jong, L. & Admiraal, W. 1984. Competition between three estuarine benthic diatom species in mixed cultures. Mar. Ecol. Prog. Ser. 18:269 75. Ford, R. B. & Honeywill, C. 2002. Grazing on intertidal microphytobenthos by macrofauna: is pheophorbide a useful marker? Mar. Ecol. Prog. Ser. 229:33 42. Forster, R. M., Créach, V., Sabbe, K., Vyverman, W. & Stal, L. J. 2006. The biodiversity-ecosystem function relationship in microphytobenthic diatoms of the Westerschelde estuary. Mar. Ecol. Prog. Ser. 229:203 15. Frostegard, A., Courtois, S., Ramisse, V., Clerc, S., Bernillon, D., Le Gall, F., Jeannin, P., Nesme, X. & Simonet, P. 1999. Quantification of bias related to the extraction of DNA directly from soils. Appl. Environ. Microbiol. 65:5409 20. Gallagher, J. C. 1982. Physiological variation and electrophoresis banding patterns of genetically different seasonal populations of Skeletonema costatum (Bacillariophyceae). J. Phycol. 18:148 62. Galluzzi, L., Penna, A., Bertozzini, E., Vila, M., Garces, E. & Magnani, M. 2004. Development of a real-time PCR assay for rapid detection and quantification of Alexandrium minutum (a dinoflagellate). Appl. Environ. Microbiol. 70:1199 206. Gregory, T. R. 2001. Coincidence, coevolution, or causation? DNA content, cell size, and C-value enigma. Biol. Rev. 76:65 101.
DISTRIBUTION OF NAVICULA IN ESTUARY 1153 Guillard, R. R. L. & Ryther, J. H. 1962. Studies on marine planktonic diatoms. 1. Cyclotella nana (Hustedt) and Detonula confervacea (Cleve) Gran. Can. J. Microbiol. 8:229 39. Haubois, A. G., Sylvestre, F., Guarini, J. M., Richard, P. & Blanchard, G. F. 2005. Spatio-temporal structure of the epipelic diatom assemblage from an intertidal mudflat in Marennes-Oleron Bay, France. Estauries Coast. Shelf Sci. 64: 385 94. Heid, C., Stevens, J., Livak, K. & Williams, P. 1996. Real Time Quantitative PCR. Genome Methods: Genome Research. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Holm-Hansen, O. 1969. Algae: amounts of DNA and organic carbon in single cells. Science 163:87 8. Knowlton, N. 1993. Sibling Species in the Sea. Annu. Rev. Ecol. Syst. 24:189 216. Kooistra, W. H. C. F., Stam, W. T., Olsen, J. L. & Vandenhoek, C. 1992. Biogeography of Cladophoropsis-membranacea (Chlorophyta) based on comparisons of nuclear rdna ITS sequences. J. Phycol. 28:660 8. Krammer, K. & Lange-Bertalot, H. 1986. Bacillariophyceae. Part 1 Naviculaceae. In Ettl, H., Gerloff, F., Heynig, H. & Mollenhauer, D. [Eds.] Süwasserflora von Mitteleuropa. G. Fischer, Stuttgart, 876 pp. Labrenz, M., Brettar, I., Christen, R., Flavier, S., Botel, J. & Höfle, M. G. 2004. Development and application of a real-time PCR approach for quantification of uncultured bacteria in the central Baltic Sea. Appl. Environ. Microbiol. 70:4971 9. Lange-Bertalot, H. 2001. Navicula sensu stricto 10 genera separated from Navicula sensu lato Frustulia. In Lange-Bertalot, H. [Ed.] Diatoms of Europe Diatoms of European Inland Waters and Comparable Habitats. Vol. 2. A. R. G. Gantner Verlag K.G., Ruggell, 26 pp. Leblanc, C., Falciatore, A., Watanabe, M. & Bowler, C. 1999. Semiquantitative RT-PCR analysis of photoregulated gene expression in marine diatoms. Plant Mol. Biol. 40:1031 44. Lipthay de, J. D., Enzinger, C., Johnsen, K., Aamand, J. & Srensen, S. J. 2004. Impact of DNA extraction method on bacterial community composition measured by denaturing gradient gel electrophoresis. Soil Biol. Biochem. 36:1607 14. Lucas, C. H., Widdows, J., Brinsley, M. D., Salkeld, P. N. & Herman, P. M. J. 2000. Benthic-pelagic exchange of microalgae at a tidal flat. 1. Pigment analysis. Mar. Ecol. Prog. Ser. 196:59 73. Mann, D. G. 1999. The species concept in diatoms. Phycologia 38:437 95. Martin-Laurent, F., Philippot, L., Hallet, S., Chaussod, R., Germon, J. C., Soulas, G. & Catroux, G. 2001. DNA extraction from soils: old bias for new microbial diversity analysis methods. Appl. Environ. Microbiol. 67:2354 9. Medlin, L. K. & Kaczmarska, I. 2004. Evolution of the diatoms: V. Morphological and cytological support for the major clades and a taxonomic revision. Phycologia 43:245 70. Medlin, L. K., Williams, D. M. & Sims, P. A. 1993. The evolution of the diatoms (Bacillariophyta). I. Origin of the group and assessment of the monophyly of its major divisions. Eur. J. Phycol. 28:261 75. Middelburg, J. J., Barranguet, C., Boschker, H. T. S., Herman, P. M. J., Moens, T. & Heip, C. H. R. 2000. The fate of intertidal microphytobenthos carbon: an in situ C-13-labeling study. Limnol. Oceanogr. 45:1224 34. Montani, S., Magni, P. & Abe, N. 2003. Seasonal and interannual patterns of intertidal microphytobenthos in combination with laboratory and areal production estimates. Mar. Ecol. Prog. Ser. 249:79 91. Mumy, K. L. & Findlay, R. H. 2004. Convenient determination of DNA extraction efficiency using an external DNA recovery standard and quantitative-competitive PCR. J. Microbiol. Methods 57:259 68. Muylaert, K., Van Nieuwerburgh, L., Sabbe, K. & Vyverman, W. 2002. Microphytobenthos communities in the freshwater tidal to brackish reaches of the Schelde estuary (Belgium). Belg. J. Bot. 135:15 26. Newby, D. T., Hadfield, T. L. & Roberto, F. F. 2003. Real-time PCR detection of Brucella abortus: a comparative study of SYBR green 1,5 0 -exonuclease, and hybridization probe assays. Appl. Environ. Microbiol. 69:4753 9. Orsini, L., Procaccini, G., Sarno, D. & Montresor, M. 2004. Multiple rdna ITS-types within the diatom Pseudo-nitzschia delicatissima (Bacillariophyceae) and their relative abundances across a spring bloom in the Gulf of Naples. Mar. Ecol. Prog. Ser. 271:87 98. Peletier, H. 1996. Long-term changes in intertidal estuarine diatom assemblages related to reduced input of organic waste. Mar. Ecol. Prog. Ser. 137:265 71. Popels, L. C., Cary, S. C., Hutchins, D. A., Forbes, R., Pustizzi, F., Gobler, C. J. & Coyne, K. J. 2003. The use of quantitative polymerase chain reaction for the detection and enumeration of the harmful alga Aureococcus anophagefferens in environmental samples along the United States East Coast. Limnol. Oceanogr.: Methods 1:92 102. Rijstenbil, J. W. 2003. Effects of UVB radiation and salt stress on growth, pigments and antioxidative defence of the marine diatom Cylindrotheca closterium. Mar. Ecol. Prog. Ser. 254: 37 47. Round, F. E. 2004. Vie et milieu of freshwater diatoms. Comment on current issues in diatom ecology and floristics. Vie et Milieu/ Life and Environment 54:157 61. Rynearson, T. A. & Armbrust, E. V. 2004. Genetic differentiation among populations of the planktonic marine diatom Ditylum brightwellii (Bacillariophyceae). J. Phycol. 40:34 43. Sabbe, K., Verleyen, E., Hodgson, D. A., Vanhoutte, K. & Vyverman, W. 2003. Benthic diatom flora of freshwater and saline lakes in the Larsemann hills and Rauer islands, east Antartica. Antarctic Sci. 15:227 48. Skovhus, T. L., Ramsing, N. B., Holmstrom, C., Kjelleberg, S. & Dahllof, I. 2004. Real-time quantitative PCR for assessment of abundance of Pseudoalteromonas species in marine samples. Appl. Environ. Microbiol. 70:2373 82. Sorhannus, U. 2004. Diatom phylogenetics inferred based on direct optimization of nuclear-encoded SSU rrna sequences. Cladistics 20:487 97. Sündback, K., Miles, A. & Goransson, E. 2000. Nitrogen fluxes, denitrification and the role of microphytobenthos in microtidal shallow-water sediments: an annual study. Mar. Ecol. Prog. Ser. 200:59 76. Suzuki, M. T., Taylor, L. T. & Delong, E. F. 2000. Quantitative analysis of small-subunit rrna genes in mixed microbial populations via 5 0 -nuclease assays. Appl. Environ. Microbiol. 66:4605 14. Thornton, D. C. O., Dong, L. F., Underwood, D. J. C. & Nedwell, D. B. 2002. Factors affecting microphytobenthic biomass, species composition and production in the Colne estuary (UK). Aquat. Microb. Ecol. 27:285 300. Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G. 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25:4876 82. Tolhurst, T. J., Jesus, B., Brotas, V. & Paterson, D. M. 2003. Diatom migration and sediment armouring an example from the Tagus estuary, Portugal. Hydrobiologia 503:183 93. Underwood, G. J. C. & Kromkamp, J. 1999. Primary production by phytoplankton and microphytobenthos in estuaries. Adv. Ecol. Res. 29:93 153. Vaulot, D., Birrien, J-L., Marie, D., Casotti, R., Veldhuis, M. J. W., Kraay, G. W. & Chretiennot-Dinet, M.-J. 1994. Morphology, ploidy, pigment composition, and genome size of cultured strains of Phaeocystis (Prymnesiophyceae). J. Phycol. 30:1022 35. Veldhuis, M. J. W., Cucci, T. L. & Sieracki, M. E. 1997. Cellular DNA content of Marine phytoplankton using two new fluorochromes: taxonomy and ecological implications. J. Phycol. 33:517 44. Wawrik, B., Paul, J. H. & Tabita, F. R. 2002. Real-time PCR quantification of rbcl (ribulose-1,5-bisphosphate carboxylase/oxygenase) mrna in diatoms and pelagophytes. Appl. Environ. Microbiol. 68:3771 9.