PCR cloning : why secondary amplification? May 26, 2009 secondary amplification amplification of the coding sequence alone or of defined fragments ligation into expression vector insertion of fusion domains or other sequence features PCR Cloning II fusion domains for purification His 6 GST chitin binding protein MBP analytical fusion tags epitope tags: His 6,Flag, HA, c-myc fluorescent tags (GFP) Epitope tags Epitope tags HA His 6 Flag c-myc V 5 YPYDVPDYA HHHHHH DYKDDDDK EQKLISEEDL GKPIPNPLLGLDST Epitope tags PCR cloning : secondary amplification Hemagglutinin HA YPYDVPDYA PCR with template concentrations product yield already in the first cycles cycle count needed linear rather than exponential mode er error propagation neuraminidase hemagglutinin 1
PCR cloning : amplification errors PCR cloning : amplification errors cycle no molecules correct error wrong after rel. wrong 30 cycles after 30 cycles 0 1 1 2 536870912 1 2 4 3 8 3 1 6 2 268435456 0,5 134217728 0,25 1.0 4 16 5 32 6 64 7 128 8 256 9 512 10 1024 11 2048 12 4096 13 8192 14 16384 15 32768 16 65536 17 131072 18 262144 19 524288 20 1048576 21 2097152 22 4194304 12 4 24 8 48 16 96 32 192 64 384 128 768 256 1536 512 3072 1024 6144 2048 12288 4096 24576 8192 49152 16384 98304 32768 196608 65536 393216 131072 786432 262144 1572864 524288 3145728 1048576 67108864 0,125 33554432 0,0625 16777216 0,03125 8388608 0,015625 4194304 0,0078125 2097152 0,00390625 1048576 0,00195313 524288 0,00097656 262144 0,00048828 131072 0,00024414 65536 0,00012207 32768 6,1035E-05 16384 3,0518E-05 8192 1,5259E-05 4096 7,6294E-06 2048 3,8147E-06 1024 1,9073E-06 512 9,5367E-07 256 4,7684E-07 misamplification after 30 cycles 0.8 0.6 0.4 0.2 0.0 0 10 20 30 log misamplification after 30 cycles 0-2 -4-6 -8-10 0 10 20 30 23 8388608 24 16777216 6291456 2097152 12582912 4194304 128 2,3842E-07 64 1,1921E-07 affected cycle affected cycle 25 33554432 25165824 8388608 32 5,9605E-08 26 67108864 50331648 16777216 16 2,9802E-08 27 134217728 100663296 33554432 8 1,4901E-08 28 268435456 201326592 67108864 4 7,4506E-09 29 536870912 402653184 134217728 2 3,7253E-09 30 1073741824 805306368 268435456 1 1,8626E-09 PCR cloning : amplification errors PCR cloning : secondary amplification starting molecules 1 10 100 1000 10000 cycle 0 1 10 100 1000 10000 1 2 20 200 2000 20000 2 4 40 400 4000 40000 3 8 80 800 8000 80000 4 16 160 1600 16000 160000 5 32 320 3200 32000 320000 6 64 640 6400 64000 640000 7 128 1280 12800 128000 1280000 8 256 2560 25600 256000 2560000 9 512 5120 51200 512000 5120000 secondary amplification features usually no free choice of primer location very sequence background (purified plasmid DNA as template) template concentration may be used insertion of 5 non-annealing sequences 10 1024 10240 102400 1024000 10240000 11 2048 20480 204800 2048000 20480000 12 4096 40960 409600 4096000 40960000 13 8192 81920 819200 8192000 81920000 14 16384 163840 1638400 16384000 163840000 15 32768 327680 3276800 32768000 327680000 16 65536 655360 6553600 65536000 655360000 17 131072 1310720 13107200 131072000 1310720000 18 262144 2621440 26214400 262144000 2621440000 19 524288 5242880 52428800 524288000 5242880000 20 1048576 10485760 104857600 1048576000 1,0486E+10 5 overhanging sequence: Kozak consensus sequence 5 overhanging sequence: restriction sites Kozak consensus sequence GCC GCC ACC ATG G insertion of RE sites into the PCR primers try to find two enzymes that cut in the same buffer that work at the same temperature make sure that there are no internal restriction sites in the amplificate to use different overhangs at the 5 and 3 end of the insert Kozak, M. (1986) Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44, 283. Kozak, M. (1987) At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J. Mol. Biol. 196, 947. 2
5 overhanging sequence: restriction sites Restriction enzymes good restriction enzymes 5 overhanging sequence: restriction sites 5 overhanging sequence: restriction sites bad restriction enzymes blunt cutters most REs don t like DNA ends! adda GC clamp(seesupplier information) methylation-dependent sites, weird reaction temperatures avoid, if possible! example: Calbindin/pGEX-2TK pgex-2tk Primer Sequence TmNN GC Pos Dir Note CCC GGA TCC ATG GCA GAA RS-174 TCC CAC CTG CAG T 59,3 0,55 start sense Clamp / BamH I / seq-spez CCC GAA TTC CTA GTT GTC RS-177 TCC AGC AGA AAG AAT A 51,2 0,4 stop antisense seq-spez / EcoR I / Clamp calbindin coding sequence: ~ 850 bp pgex-2tk is a vector for IPTG-driven expression from E.coli 3
example: CB/pGEX-2TK The sense-primer RS-174 CCC GGATCC ATGGCAGAATCCCACCTGCAGT G S M A E S H L Q Clamp BamH I Sequence-specific example: CB/pGEX-2TK The antisense-primer (displayed as reverse-complement!) RS-177 3 -TATTCTTTCTGCTGGAGACAAC TAG GAATTC GGG-5 I L S A D G N. E F Sequence-specific EcoR I Clamp CB Amplification 1. Template a 2. Template b Ligation RS-174/ RS-177 (850 bp) 2.0/50 (x15) 1 @72, Pfu/Taq gel elution (QIAgen) EcoR I/ BamH I restriction digest agarose gel electrophoresis ligation into pgex-2tk ligation efficiency is dependent on DNA concentration ligase concentration temperature buffer viscosity time component concentrations dimer formation circularization DNA concentration ligase concentration buffer viscosity 4
1x T4 ligase buffer (NEB) 50 mm Tris-HCl (ph 7.5) 10 mm MgCl2 10 mm dithiothreitol, 1 mm ATP 25 μg/ml bovine serum albumin ligation experiment monomer (900 bp) dimer Unit Definition One Cohesive End Ligation Unit is defined as the amount of enzyme required to give 50% ligation of Hind III digested λ DNA in 30 minutes at 16 C in 20 μl at a 5 termini oncentration of 0.12 μm (300 μg/ml). circularized dimer ligase concentration 100 ng fragment, ligation for 30 min at RT ligation temperature temperature (16 C) temperature (RT) good bad annealing ligase activity ligation time 0.5 µl ligase, 100 ng insert, 100 ng vector, 23 C troubleshooting the ligation reaction optimize ligase concentration choose enzyme concentration that gives maximum amount of dimers optimize vector concentration ligate 15 min at RT, choose sample with maximum amount of dimers recircularize dilute 10 x and add ligase concentration, incubate 4 h or o/n at 16 C incubation time (min) find troubleshooting guide here: http://labs.fhcrc.org/fero/protocols/ligation.html 5
conclusions incubate at 16 C for difficult ligations, increase ligation time optimize DNA concentration avoid blunt end ligations prefer asymmetric ligations always include a vector religation control CB Amplification 1. Template a 2. Template b RS-174/ RS-177 (850 bp) 2.0/50 (x15) 1 @72, Pfu/Taq gel elution (QIAgen) EcoR I/ BamH I restriction digest agarose gel electrophoresis ligation into pgex-2tk CB/pGEX-2TK colony-pcr 1. Template a 2. Template b RS-176/ RS-160 (318 bp) 2.0/50 (x25) 35 @72, Pfu/Taq CB protein expression 1. CB (1:10) 2. CB-biotin (1:10) 3. CB (1:1) 4. CB-biotin (1:1) Ponceau stain Avidin-POD stain 6