Supplementary Data. Flvcr1a TCTAAGGCCCAGTAGGACCC GGCCTCAACTGCCTGGGAGC AGAGGGCAACCTCGGTGTCC

Similar documents
Transcription:

Supplementary Data Supplementary Materials and Methods Measurement of reactive oxygen species accumulation in fresh intestinal rings Accumulation of reactive oxygen species in fresh intestinal rings was assessed using the oxidant-sensitive fluorescent dye 29, 79-dichlorodihydrofluoroscein diacetate (H 2 DCFDA; Molecular Probes, Inc.). Mouse intestine was dissected after transcardial perfusion of mice with phosphate-buffered saline (PBS). Fresh intestinal everted rings (three for every mouse) were incubated with 20 lm H 2 DCFDA in PBS for 30, 40, and 50 min at 37 C under 5% CO 2 atmosphere. Fluorescence was recorded at excitation and emission wavelengths of 485 and 530, respectively, on a Glomax Multi Detection System (Promega Corporation). The background fluorescence of rings untreated with H 2 DCFDA, as well as that of rings treated with H 2 DCFDA before incubation, and that of H 2 DCFDA alone in PBS was subtracted from the total fluorescence. Fluorescence intensity units were normalized by mg of tissue weight. Results are expressed as arbitrary fluorescence unit/mg of tissue. Lipid peroxidation Lipid peroxidation from tissue extracts was measured using the colorimetric assay kit Bioxytech LPO-586 (Oxis International) according to the manufacturer s instructions. Supplementary Table S1. Sequences of Primers Used for Polymerase Chain Reaction Primers used for PCR Name Forward1 5-3 Forward2 5-3 Reverse 5-3 Flvcr1a TCTAAGGCCCAGTAGGACCC GGCCTCAACTGCCTGGGAGC AGAGGGCAACCTCGGTGTCC PCR primers, Forward2 and Reverse, amplify a 500-bp (base pair) fragment from the intact Flvcr1a flox/flox allele, whereas primers, Forward1 and Reverse, amplify a 320-bp fragment from the recombined allele. Under the PCR conditions used, these primers failed to amplify the predicted 1560-bp fragment from the full-length Flvcr1a flox/flox allele. PCR, polymerase chain reaction. Supplementary Table S2. Disease Parameters in Survived Mice Upon Induction of Ulcerative Colitis Cre- day 17 Cre+ day 17 Number of survived animals 5 of 6 2 of 6 Colon length (cm) 8.300 0.300 (n = 5) 7.950 0.050 (n = 2) Body weight (g) 27.68 1.478 (n = 5) 27.70 3.200 (n = 2) Disease score 2.600 0.245 (n = 5) 2.500 0.500 (n = 2) Colon length, body weight, and disease score of Flvcr1a flox/flox (Cre-) and Flvcr1a flox/flox ;Vil-Cre (Cre+) mice at day 17 of the experiment (10 days after the cessation of DSS administration). Data are referred to the sole animals that survived following the cessation of DSS administration. The number of survived animals upon cessation of DSS administration is indicated in the first line of the table. DSS, dextran sulfate sodium.

SUPPLEMENTARY FIG. S2. FLVCR1a protein is located at the plasma membrane of intestinal cells. (A) Undifferentiated Flvcr1a-Myc expressing Caco2 cells stained with DAPI (i) to visualize nuclei, wheat germ agglutinin (ii) to visualize cell membranes and an antibody to MYC (iii) to visualize FLVCR1a-MYC. The merged image is shown in (iv). Bar = 20 lm. SUPPLEMENTARY FIG. S1. Generation of intestinespecific conditional Flvcr1a-null mice. (A) Representative PCR analysis on genomic DNA from different Flvcr1a flox/flox (Cre-) andflvcr1a flox/flox ;Vil-Cre (Cre+) tissues. The upper band corresponds to a 500-base pair (bp) long fragment of the intact Flvcr1a flox/flox allele, whereas the lower band to a 320-bp fragment of the recombinant allele. (B) qrt-pcr analysis of Flvcr1a expression in the duodenum and colon of Flvcr1a flox/flox (Cre-) and Flvcr1a flox/flox ;Vil-Cre (Cre+) mice. Transcript abundance, normalized to 18s mrna expression, is expressed as a fold increase over a calibrator sample. Data represent mean SEM, n = 5; **p < 0.01. (C) Different tissue sections of 2-month-old Flvcr1a flox/flox (Cre-) and Flvcr1a flox/flox ;Vil-Cre (Cre+) mice stained with H&E. Bar = 100 lm. (D) Colon rectum sections of 10- month-old Flvcr1a flox/flox (Cre-) and Flvcr1a flox/flox ;Vil-Cre (Cre+) mice stained with H&E. Bar = 350 lm. PCR, polymerase chain reaction. H&E, hematoxylin and eosin. SUPPLEMENTARY FIG. S3. Downmodulation of FLVCR1a mrna in Caco2 cells using a specific shrna. qrt-pcr analysis of FLVCR1a expression in Caco2 cells, in which the expression of FLVCR1a was downregulated using a specific shrna. Transcript abundance, normalized to beta-actin mrna expression, is expressed as a fold increase over a calibrator sample. Data represent mean SEM, n = 6; ***p < 0.001. qrt-pcr, quantitative real-time PCR; shrna, short hairpin RNA.

SUPPLEMENTARY FIG. S4. Lack of Flvcr1a in the intestine does not affect dietary heme absorption. Tissue sections of Flvcr1a flox/flox (Cre-) and Flvcr1a flox/flox ;Vil-Cre (Cre+) mice stained with Perls reaction. Bar = 100 lm. SUPPLEMENTARY FIG. S5. Modulation of heme-controlled genes in the duodenum upon dietary heme supplementation. (A) qrt-pcr analysis of Ho1, Fpn1, and Flvcr1a expression in the duodenum of wild-type mice maintained on a heme-supplemented diet for 7 days. Control mice were maintained on a standard diet and represented the 0 time point of the treatment in the experiment. Transcript abundance, normalized to 18s mrna expression, is expressed as a fold increase over a calibrator sample. Data represent mean SEM, n = 6; *p < 0.05, **p < 0.01. (B) HO activity in the duodenum of wildtype mice maintained on a heme-supplemented diet for 1 and 7 days. Control mice were maintained on a standard diet and represented the 0 time point of the treatment in the experiment. Values are expressed as pmol of bilirubin per mg protein produced in 1 h. Data represent mean SEM; n = 3. *p < 0.05.

SUPPLEMENTARY FIG. S6. Loss of Flvcr1a does not affect redox status in mice intestine. (A) qrt-pcr analysis of Sod1, Ggcs, and Txnrd1 expression in the duodenum of Flvcr1a flox/flox (Cre-) and Flvcr1a flox/flox ;Vil-Cre (Cre+) mice. Transcript abundance, normalized to 18s mrna expression, is expressed as a fold increase over a calibrator sample. Data represent mean SEM, n = 5; *p < 0.05. (B) ROS amount in fresh intestinal everted rings from Flvcr1a flox/flox (Cre-) and Flvcr1a flox/flox ;Vil-Cre (Cre+) mice measured by detection of H 2 DCFDA fluorescence at different times(30, 40, and 50 min) of tissue incubation with this probe. Values are expressed as arbitrary fluorescence unit/mg tissue. Data represent mean SEM, n = 5. (C) Lipid peroxidation measured as malondialdehyde (MDA) content in the intestine of Flvcr1a flox/flox (Cre-) and Flvcr1a flox/flox ;Vil-Cre (Cre+) mice. Values are expressed as pmol of MDA/mg tissue. Data represent mean SEM, n = 6. ROS, reactive oxygen species.

SUPPLEMENTARY FIG. S7. Loss of FLVCR1a does not affect apoptosis and cell cycle in Caco2 cells. (A) Representative flow cytometric analyses of apoptosis in Caco2 cells, in which the expression of FLVCR1a was downregulated using a specific shrna. The graph shows the percentage of apoptotic cells with respect to the entire population analyzed. Data represent mean SEM, n = 3. Data are representative of three independent experiments. (B) Representative flow cytometric analyses of cell cycle in Caco2 cells, in which the expression of FLVCR1a was downregulated using a specific shrna. The graphs show the percentage of cells in the different cell cycle phases with respect to the entire population analyzed. Data represent mean SEM, n = 3. Data are representative of three independent experiments. SUPPLEMENTARY FIG. S8. Tissue regeneration in survived mice upon induction of ulcerative colitis. Representative sections of the colon rectum of Flvcr1a flox/flox (Cre-) (i, iii) and Flvcr1a flox/flox ;Vil-Cre (Cre+) (ii, iv) mice treated with DSS and stained with H&E. Colon rectum was dissected at day 17 of the experiment (10 days after the cessation of DSS administration). Higher magnification of sections i and ii is shown in iii and iv, respectively. Bar (i, ii) = 2000 lm; bar (iii, iv) = 200 lm. DSS, dextran sulfate sodium.