Ion TrueMate Library Preparation

USER GUIDE Ion TrueMate Library Preparation for use with: Ion TrueMate Library Kit Ion TrueMate Plus Library Kit Catalog Numbers A25614 and A25656 Publication Number MAN0010280 Revision B.0 For Research Use Only. Not for use in diagnostic procedures.

The information in this guide is subject to change without notice. DISCLAIMER TO THE EXTENT ALLOWED BY LAW, LIFE TECHNOLOGIES AND/OR ITS AFFILIATE(S) WILL NOT BE LIABLE FOR SPECIAL, INCIDENTAL, INDIRECT, PUNITIVE, MULTIPLE, OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT, INCLUDING YOUR USE OF IT. Important Licensing Information This product may be covered by one or more Limited Use Label Licenses. By use of this product, you accept the terms and conditions of all applicable Limited Use Label Licenses. This product was developed and manufactured by Lucigen Corporation, Middleton, WI. Trademarks All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified. Accura, ChimeraCode, and JunctionCode are trademarks of Lucigen, used under permission and license. AMPure and Agencourt are trademarks of Beckman Coulter, Inc. Eppendorf LoBind and Thermomixer are trademarks of Eppendorf AG. Aligent and Bioanalyzer are trademarks of Agilent Technologies, Inc. Hydroshear is a trademark of Digilab, Inc. Megaruptor is a trademark of Diagenode SA. Pippen Prep is a trademark of Sage Science. DNASTAR, Lasergene, and SeqMan NGen are trademarks of DNASTAR, Inc. 2015 Thermo Fisher Scientific Inc. All rights reserved.

Contents About this guide... 6 Revision history... 6 CHAPTER 1 Product information... 7 Product description... 7 Kit compatibility... 7 Kit contents and storage... 7 Required materials and equipment... 9 Procedure guidelines... 10 Procedure overview... 11 Workflow diagram... 12 CHAPTER 2 Before you begin... 13 Determine optimal restriction enzyme(s) for digestion... 13 Restriction enzyme options... 13 General digestion set-up... 14 Example restriction enzyme digests... 15 CHAPTER 3 Prepare adapter-compatible DNA... 18 Shear DNA to appropriate size... 18 Purify sheared DNA... 19 Confirm size and quantity of purified sheared DNA... 20 End repair DNA... 20 A-tail DNA... 21 CHAPTER 4 Ligate adapters to DNA fragments... 22 Ligate adapters to DNA fragments... 22 Clean up barcoded DNA... 23 Ion TrueMate Library Preparation 3

Contents CHAPTER 5 Size-select DNA and ligate to coupler... 25 Size-select barcoded DNA... 25 Ligate size-selected DNA to coupler... 27 Remove linear DNA... 28 Bead clean-up... 29 CHAPTER 6 Restriction digest and purify target DNA... 30 Digest insert/coupler... 30 Biotin-capture to remove unwanted DNA fragments... 31 CHAPTER 7 Ligate JunctionCode sequence and recircularize DNA... 33 Ligate JunctionCode sequence to biotin-captured insert/coupler... 33 Clean up JunctionCode -ligated DNA... 34 Re-circularize DNA... 35 Remove unwanted linear DNA... 36 Clean up exonuclease-treated insert/coupler... 36 CHAPTER 8 Amplify DNA... 38 Identify optimal amplification conditions... 38 Generate amplified library... 40 CHAPTER 9 Size select library... 42 Purify amplified library... 42 (Recommended) Size select library using Pippin Prep... 43 Purify mate-pair library... 43 (Optional) Size select library using AMPure beads... 44 First-round purification... 45 Second-round purification... 45 CHAPTER 10 Sequence data analysis... 48 Ion PGM sequence data analysis... 48 APPENDIX A Troubleshooting... 49 APPENDIX B Restriction enzyme choice... 51 Mate-tag size depends on restriction enzyme choice... 51 4 Ion TrueMate Library Preparation

Contents APPENDIX C DNA size selection vs. insert size... 52 DNA size selection vs. insert size... 52 APPENDIX D Determining bead concentration... 53 Determining bead concentration for size selection... 53 APPENDIX E Sequence analysis... 54 Overview... 54 Software requirements... 54 Sequence analysis example... 55 Assembly software options... 55 APPENDIX F Sequence and location information... 57 Barcode adapters and JunctionCode Sequence... 57 ChimeraCode Sequences... 57 APPENDIX G Additional test reactions for library amplification... 59 Additional test reactions for library amplification... 59 Safety... 63 Chemical safety... 64 Biological hazard safety... 65 Documentation and support... 66 Obtaining SDSs... 66 Obtaining Certificates of Analysis... 66 Limited product warranty... 66 Customer and technical support... 66 Ion TrueMate Library Preparation 5

About this guide IMPORTANT! Before using this product, read and understand the information in the Safety appendix in this document. Revision history Revision Date Description A.0 25 July 2014 New user guide B.0 12 March 2015 Revised software scripts Revised software example 6 Ion TrueMate Library Preparation

1 Product information Product description The Ion TrueMate Library Kit and Ion TrueMate Plus Library Kit are designed to generate mate pair libraries, with inserts 2 8 Kb in size, for sequencing on the Ion PGM System. Kit compatibility Ion TrueMate Library kits (Cat. nos. A25614 and A25656) are compatible with the Ion PGM Template OT2 400 Kit (Cat. no. 4479878), Ion PGM Sequencing 400 Kit (Cat. no. 4482002), and Ion 318 Chip Kit v2 (Cat. no. 4484354) for use with the Ion PGM System. Kit contents and storage Ion TrueMate Library Kit (Cat. no. A25614) and Ion TrueMate Plus Library Kit (Cat. no. A25656) include the following: Ion TrueMate End Repair Kit [1] Component Cap color Quantity Volume Storage Elution Buffer clear 1 520 µl End Repair Tailing Buffer End Repair Enzyme Mix red 2 1 ml red 1 160 µl 30 C to 10 C Klenow Fragment violet 1 160 µl Barcode A white 1 480 µl Ligase blue 1 320 µl Ion TrueMate Library Preparation 7

1 Chapter 1 Product information Kit contents and storage Ion TrueMate Library Reagents [2] Component Cap color Quantity Volume Storage Elution Buffer clear 5 1.6 ml Klenow Fragment violet 1 60 µl Ligase blue 1 105 µl Mate Pair Coupler Mix red 1 30 µl 10X Ligase Buffer blue 1 600 µl Nuclease I black 1 100 µl Nuclease II black 1 75 µl Biotin Wash Buffer yellow 4 1.5 ml Biotin Capture Buffer Biotin Capture Reagent Biotin Elution Buffer yellow 1 450 µl yellow 1 15 µl yellow 1 520 µl 30 C to 10 C Tailing Buffer orange 1 500 µl JunctionCode Sequence T4 Polynucleotide Kinase Accura Hot Start 2X Master Mix Amplification Primer Mix white 1 60 µl green 1 20 µl brown 1 1.3 ml brown 1 260 µl [1] May be ordered separately (Part. no. A25655). [2] May be ordered separately (Part. no. A25652). In addition, the Ion TrueMate Plus Library Kit (Cat. no. A25656) also includes: Ion TrueMate RE Kit [1, 2] Component Cap color Quantity Volume Storage Rsa I (10 U/µL) red 1 tube 30 µl Alu I (10 U/µL) orange 1 tube 30 µl Hae III (10 U/µL) yellow 1 tube 30 µl 30 C to 10 C Acc II (10 U/µL) green 1 tube 30 µl 8 Ion TrueMate Library Preparation

Chapter 1 Product information Required materials and equipment 1 Ion TrueMate RE Kit [1, 2] Component Cap color Quantity Volume Storage 10X RE Buffer white 1 tube 120 µl 30 C to 10 C [1] May be ordered separately (Part. no. A25653). [2] Thaw all kit reagents on ice prior to use. Required materials and equipment Unless otherwise specified, all materials are available from Life Technologies (www.lifetechnologies.com). MLS: Fisher Scientific (www.fisherscientific.com) or major laboratory supplier. Component Supplier Cat. No. Quantity (Optional) HpyCH4V Restriction Enzyme 10X CutSmart Buffer New England Biolabs R0620S 1 Dynabeads MyOne Streptavidin C1 Agencourt AMPure XP Magnetic Beads Life Technologies 65001 1 Beckman Coulter A63882 1 100% Ethanol MLS Nuclease-Free Water Ambion AM9930, AM9932, AM9937, AM9938, or AM9939 1.5-mL Eppendorf LoBind Tubes 0.2-mL thin wall PCR tubes Qubit dsdna BR Assay Kit Agilent High Sensitivity DNA Kit (Optional) DNA 12000 Kit Qubit 2.0 Fluorometer or equivalent Eppendorf 022431021 1 Eppendorf 951010006 1 Life Technologies Q32850 1 Agilent 5067-4626 1 Agilent 5067-1508 1 Life Technologies Q32866 1 Thermomixer R Eppendorf 22670107 1 Heat blocks (25 C 80 C) MLS 3 Ion TrueMate Library Preparation 9

1 Chapter 1 Product information Procedure guidelines Component Supplier Cat. No. Quantity DynaMag -2 Magnet Life Technologies 12321D 1 One of the following: GeneAmp PCR System 9700 Single or Dual 96- well Thermal Cycler Life Technologies See web product pages 1 AB 2720 Thermal Cycler Veriti 96-well Thermal Cycler ProFlex 96-Well PCR System Microcentrifuge (for quick ~ 2000 x g spins) MLS 1 Agilent 2100 Bioanalyzer Instrument Agilent G2939AA 1 Sage Pippin Prep Sage Science See web product pages 1 Pippin Prep 1.5% Agarose Cassettes Sage Science CDF 1510 Electrophoresis equipment and reagents or E Gel system One of the following: HydroShear Megaruptor Covaris g-tube Digilab Inc. Diagenode Inc. Covaris See web product pages 520079 or 520104 1 Procedure guidelines Use good laboratory practices to minimize cross-contamination of products. If possible, perform library construction in an area or room that is distinct from that of template preparation. Perform all steps requiring 1.5 ml tubes with 1.5 ml Eppendorf LoBind tubes (Eppendorf Cat. no. 022431021). Thaw reagents on ice before use, and keep enzymes at 30 C to 10 C until ready to use. Mix reagents thoroughly before use, especially if frozen and thawed. 10 Ion TrueMate Library Preparation

Chapter 1 Product information Procedure overview 1 Procedure overview Using this method, genomic DNA is sheared to 400 500 bp fragments, end-repaired, A-tailed, and ligated to barcode adapters. The inserts are size-selected and ligated to a unique coupler that contains encrypted ChimeraCode sequences that help identify true mates, minimizing false mate pair fragment configurations. The circularized inserts are then treated with exonuclease to remove unwanted linear DNA, and then digested with a selection of endonucleases to produce the correctly sized mate-tags (di-tags). Biotin capture is used to remove the unwanted DNA fragments prior to the addition of a JunctionCode sequence that identifies mate pair fragment junctions. The library is re-circularized and amplified by PCR, prior to template preparation and sequencing on the Ion PGM System. Ion TrueMate Library Preparation 11

1 Chapter 1 Product information Workflow diagram Workflow diagram Figure 1: Schematic of Ion TrueMate library construction. 12 Ion TrueMate Library Preparation

2 Before you begin Determine optimal restriction enzyme(s) for digestion Note: The procedure described in this section is designed to determine the optimal restriction enzymes to use in Digest insert/coupler on page 30. Before proceeding with library construction, the restriction enzyme(s) needed to digest the gdna to 400 500 bp (desired final library after PCR amplification) must be identified. This step is critical to ensure the kit performs as designed and the sequencing coverage is uniform. The restriction enzyme(s) needed will vary for each genome. The optimal digestion method may be multiple digests with individual restriction enzymes or multiple digests with a combination of two or more restriction enzymes. Each enzyme or combination of enzymes will produce a different digestion pattern and will add diversity to the genome coverage. We recommend performing multiple digestion reactions using both individual restriction enzymes and combinations of enzymes provided in the Ion TrueMate RE Kit, and then visualize the digest results on an E-Gel, Agilent Bioanalyzer, or agarose gel. Start by digesting with the four individual restriction enzymes. After visualizing these digests on a gel, subsequent combination digests can be tested. For example, two or more infrequent cutting enzymes can be combined to produce the desired digestion pattern. The four included restriction enzymes will likely be sufficient to obtain desired results; however, if you require additional ones, we recommend HpyCH4V (New England Biolabs, Cat. no. R0626S). Example gels using both the provided enzymes as well as HpyCH4V are included in Example restriction enzyme digests on page 15. See Appendix B, Restriction enzyme choice, for additional information on the impact of the restriction enzyme choice on the final library. Restriction enzyme options Enzyme Rsa I (10U/µL) Source Ion TrueMate RE Kit Alu I (10U/µL) Hae III (10U/µL) Acc II (10U/µL) HpyCH4V (5U/µL) New England Biolabs Ion TrueMate Library Preparation 13

2 Chapter 2 Before you begin General digestion set-up General digestion set-up 1. Add the following reagents to 0.2 ml thin wall PCR tube(s): Reagent gdna Buffer [1] Final amount per reaction 200 ng Restriction enzyme(s) [2,3] 10 Units [4] Nuclease-Free Water to 40 µl Total 40 µl [1] Use of 10X RE Buffer (supplied in Ion TrueMate RE Kit) or CutSmart Buffer (NEB) is highly recommended. Buffers from other vendors have not been tested and may not be compatible with the restriction enzyme(s) used to digest the gdna. [2] If using a pool of restriction enzymes, mix 10 Units of each enzyme in a 1.5 ml LoBind tube and use 1 µl for the digest. [3] HpyCH4V can be used in either 10X RE Buffer (supplied in Ion TrueMate RE Kit) or CutSmart Buffer (NEB). [4] Not to exceed 4 µl. 1X 2. Mix by pipetting up and down 10 times. 3. Incubate reaction(s) at 37 C for 30 minutes. 4. Run reaction(s) alongside undigested gdna on 1.7% agarose gel with DNA ladder (e.g. 100 bp ladder). 5. Review results and determine optimal restriction enzyme(s). Note: Ideal digests will contain the majority of the smear within 400 500 bp size range. For optimal sequencing results, perform two restriction digests using at least one enzyme for each digest and pool the digested material prior to cleanup (see figures 2, 3, and 4). The table below provides recommendations for restriction enzymes for three reference genomes: Genome GC content Restriction enzymes E. coli (DH10B) 50% Reaction 1: HpyCH4V Reaction 2: Acc II T. aquaticus 68% Reaction 1: Alu I Reaction 2: Rsa I + Acc II H. sapiens 50% Reaction 1: Alu I Reaction 2: Hae III + Rsa I 14 Ion TrueMate Library Preparation

Chapter 2 Before you begin Example restriction enzyme digests 2 Example restriction enzyme digests The gel images below provide examples of restriction enzyme testing that were used to identify recommended restriction enzymes: Figure 2: Results of E. coli restriction digest testing. Optimal results are seen with HpyCH4V and Acc II. Ion TrueMate Library Preparation 15

2 Chapter 2 Before you begin Example restriction enzyme digests Figure 3: Results of T. aquaticus restriction digest testing. Optimal results are seen with AluI and RsaI +AccII. 16 Ion TrueMate Library Preparation

Chapter 2 Before you begin Example restriction enzyme digests 2 Figure 4: Results of human gdna restriction digest testing. Optimal results are seen with AluI and HaeIII + RsaI. Ion TrueMate Library Preparation 17

3 Prepare adapter-compatible DNA Shear DNA to appropriate size During this step, the genomic DNA (gdna) is sheared to an average size range that is larger than the desired insert size. See Appendix B, DNA size selection vs. insert size on page 52 for additional information on shearing and size selection. Note: gdna used must be free of contaminating RNA. A sample loss of 20 50% is expected during shearing and bead clean up. The percentage of sample loss will vary depending on the shearing method used. This expected loss should be taken into account when determining the amount of gdna to shear. The table below provides examples of recommended shearing size, amount of starting gdna, and shearing method for various libraries: Desired insert size Sheared fragment size Recommended amount of starting material Recommended shearing method [1] 2 Kb 3 Kb 2.5 3 µg 3 Kb setting with Megaruptor short hydropore [2] 5 Kb 6 Kb 3.5 5 µg 8 Kb setting with Covaris g- TUBES or Megaruptor 8 Kb 10 Kb 11.5 16 µg 10 Kb setting with Covaris g- TUBES or Megaruptor [1] Use manufacturer's recommended protocols. [2] Higher sample loss (up to 50 or 60%) is expected using the Megaruptor. 18 Ion TrueMate Library Preparation

Chapter 3 Prepare adapter-compatible DNA Purify sheared DNA 3 Purify sheared DNA The following protocol describes how to perform a bead clean-up to concentrate and purify the sheared DNA from the previous step. IMPORTANT! Reagents used from this point through "Ligate adapters to DNA fragments" are included in the End Repair Kit (Cat. no. A25655). 1. Transfer the sheared gdna into a 1.5 ml LoBind tube. 2. Add an equal volume AMPure XP beads to the sheared gdna at room temperature to obtain a 1:1 ratio of beads to sample. 3. Mix the beads and gdna gently by pipetting up and down 10 times. 4. Incubate the mixture at room temperature for 5 minutes. Do not keep the tube in the magnetic rack during incubation. 5. Pulse-spin to bring the contents to the bottom of the tube. Place in the magnetic rack for 5 minutes, or until the solution becomes clear. 6. Carefully remove and discard the supernatant with a pipet, without disturbing the bead pellet. 7. Without removing the tube from the magnet, add 750 μl of freshly prepared 70% ethanol. 8. Incubate for 30 seconds, turning the tube around twice in the magnet to move the beads around. After the solution clears, remove and discard the supernatant without disturbing the pellet. 9. Repeat step 7 and 8 for a second wash. 10. Pulse-spin the tube, place it back in the magnetic rack, and remove any remaining residual ethanol with a 20-μL pipettor, without disturbing the pellet. 11. Keeping the tube on the magnet, air-dry the beads at room temperature for ~5 minutes. 12. Remove the tube from the magnetic rack, and add 52 μl of Elution Buffer (from End Repair Kit) directly to the pellet to disperse the beads. 13. Mix thoroughly by pipetting the suspension up and down 5 times. Do not vortex the tube. 14. Pulse-spin and place the tube in the magnetic rack for at least one minute until the solution clears. 15. Transfer 50 μl of the supernatant containing the sheared DNA to a new 1.5 ml LoBind tube for size confirmation and quantitation. Ion TrueMate Library Preparation 19

3 Chapter 3 Prepare adapter-compatible DNA Confirm size and quantity of purified sheared DNA Confirm size and quantity of purified sheared DNA 1. Confirm the size of the sheared gdna by visualization on a 0.8% E-Gel, Agilent Bioanalyzer with the DNA 12000 Kit, or agarose gel. See Appendix C, DNA size selection vs. insert size, panel C, for example images of sheared gdna. 2. Quantify the sample using the Qubit dsdna BR Assay Kit with the Qubit 2.0 Fluorometer according to manufacturer's instructions. The following table provides information about minimum amounts and concentrations of DNA required to proceed: Insert size Minimum amount of DNA required Minimum concentration of DNA required (after elution) up to 2 Kb 1.0 µg ³22 ng/µl > 2 5 Kb 2.5 µg ³50 ng/µl >5 8 Kb 8 µg ³160 ng/µl STOPPING POINT DNA may be stored at 10 C overnight. For longer periods, store at 20 C. End repair DNA During this step, the purified, sheared gdna is end repaired. Each end-repair reaction is limited by the number of DNA molecules. Therefore, the number of reactions performed at this step is determined by the insert size: Insert size Recommended number of reactions Up to 2 Kb 2 > 2 5 Kb 5 > 5 8 Kb 8 1. Aliquot gdna into 0.2-mL thin-wall PCR tubes, then add the following components to each tube: Component Amount per reaction (< 5 Kb inserts) Amount per reaction (³ 5 8 Kb inserts) Purified, sheared gdna 500 ng 1 µg End Repair Tailing Buffer (red cap) 25 µl 25 µl End Repair enzyme Mix (red cap) 2 µl 2 µl Nuclease-Free Water up to 23 µl up to 23 µl Total 50 µl 50 µl 2. Mix by pipetting up and down 10 times. 20 Ion TrueMate Library Preparation

Chapter 3 Prepare adapter-compatible DNA A-tail DNA 3 3. Place tube(s) in a thermocycler and run the following program: Step Temperature Time 1 25 C 20 min 2 72 C 25 min 3 4 C Hold 4. Proceed directly to A-tail DNA on page 21. A-tail DNA During this step, end-repaired gdna from the previous step is A-tailed. The A-tailing reactions are performed in the same tubes used for the end-repair step. 1. Add the following reagent in order to the tubes containing end-repaired DNA: Reagent Volume per reaction End-repaired gdna 50 µl Klenow Fragment (violet cap) 2 µl Total 52 µl 2. Mix by pipetting up and down 10 times. 3. Place the tubes in a thermocycler and run the following program: Step Temperature Time 1 37 C 20 min 2 70 C 15 min 3 4 C Hold 4. Proceed to Chapter 4, Ligate adapters to DNA fragments. Ion TrueMate Library Preparation 21

4 Ligate adapters to DNA fragments Ligate adapters to DNA fragments 1. Add the following reagents in order to the tubes containing the A-tailed DNA: IMPORTANT! Mix the Barcode Adapter A by pipetting up and down and spinning down prior to use. Do NOT vortex. Reagent Volume per reaction A-tailed gdna 52 µl Barcode Adapter A (white cap) 6 µl Ligase (blue cap) 4 µl Total 62 µl 2. Mix by pipetting up and down 10 times. 3. Place the tube in a thermocycler and run the following program: Step Temperature Time 1 25 C 30 min 2 70 C 15 min 3 4 C Hold 4. Pulse-spin the tubes briefly to collect the solution. 5. Combine the reactions from each library into a new 1.5 ml LoBind tube. Total volume = # of reactions x 62 μl = Note: There is now only one tube for each sample (library) until the amplification step. 6. Proceed directly to Clean up barcoded DNA on page 23. IMPORTANT! Reagents used prior to this point are included in the End Repair Kit (Cat. no. A25655). Reagents used after this point are included in the Library Reagent Kit (Cat. no. A25652). 22 Ion TrueMate Library Preparation

Chapter 4 Ligate adapters to DNA fragments Clean up barcoded DNA 4 Clean up barcoded DNA During this step, the insert with the ligated barcode adapter is cleaned up using a buffer exchange reaction. 1. Prepare the following reaction at room temperature: Reagent 1 barcoded reaction Volume per reaction 2 pooled reactions ( 2 Kb insert) 5 pooled reactions (> 2-5 Kb insert) 8 pooled reactions (> 5-8 Kb insert) Barcoded DNA 62 µl 124 µl 310 µl 496 µl AMPure XP Beads 62 µl 124 µl 310 µl 496 µl Total 124 µl 248 µl 620 µl 992 µl 2. Mix tube contents gently by pipetting up and down 10 times. 3. Incubate the mixture at room temperature for 5 minutes. Do not keep the tube in the magnetic rack during incubation. 4. Pulse-spin to bring the contents to the bottom of the tube. Place in the magnetic rack for 5 minutes, or until the solution becomes clear. 5. Carefully remove and discard the supernatant with a pipettor, without disturbing the bead pellet. 6. Without removing the tube from the magnet, add 750 μl of freshly prepared 70% ethanol. 7. Incubate for 30 seconds, turning the tube around twice in the magnet to move the beads around. After the solution clears, remove and discard the supernatant without disturbing the pellet. 8. Repeat step 7 and 8 for a second wash. 9. Pulse-spin the tube, place it back in the magnetic rack, and remove any remaining residual ethanol with a 20-μL pipettor, without disturbing the pellet. 10. Keeping the tube on the magnet, air-dry the beads at room temperature for ~5 minutes. 11. Remove the tube from the magnetic rack, and add 402 μl of Elution Buffer directly to the pellet to disperse the beads. 12. Mix thoroughly by pipetting the suspension up and down 5 times. Do not vortex the tube. 13. Pulse-spin and place the tube in the magnetic rack for at least one minute until the solution clears. Ion TrueMate Library Preparation 23

4 Chapter 4 Ligate adapters to DNA fragments Clean up barcoded DNA 14. Transfer 400 μl of the supernatant to a new 1.5 ml LoBind tube. STOPPING POINT DNA may be stored at 10 C overnight. For longer periods, store at 20 C. 24 Ion TrueMate Library Preparation

5 Size-select DNA and ligate to coupler Size-select barcoded DNA Prior to size-selection, you must determine the required bead concentration. The appropriate bead concentration is based on the lower end of the size distribution of the desired insert length. See Appendix D, Determining bead concentration for additional information. IMPORTANT! The temperature of the AMPure beads is critical to the success of the size selection step. They must be kept on ice constantly until added to cleaned insert with ligated barcode. Determining required bead concentration: Low end of size distribution Bead concentration Sample volume Bead volume 1.2 Kb 0.50X 400 µl 200 µl 2.0 Kb 0.43X 400 µl 172 µl 2.4 Kb 0.40X 400 µl 160 µl 5.0 Kb 0.38X 400 µl 152 µl 8.0 Kb 0.38X 400 µl 152 µl Record bead volume here: 1. Add the following reagents in order to the tube with the barcoded DNA: Reagent Volume Barcoded DNA 400 µl AMPure XP Beads Total Note: Perform the following steps at room temperature: 2. Mix gently by pipetting up and down 10 times. X (see table above) 400 µl + X Ion TrueMate Library Preparation 25

5 Chapter 5 Size-select DNA and ligate to coupler Size-select barcoded DNA 3. Incubate the mixture at room temperature for 5 minutes. Do not keep the tube in the magnetic rack during incubation. 4. Pulse-spin to bring the contents to the bottom of the tube. Place in the magnetic rack for 5 minutes, or until the solution becomes clear. 5. Carefully remove and discard the supernatant with a pipettor without disturbing the bead pellet. 6. Without removing the tube from the magnet, add 750 μl of freshly prepared 70% ethanol. 7. Incubate for 30 seconds, turning the tube around twice in the magnet to move the beads around. After the solution clears, remove and discard the supernatant without disturbing the pellet. 8. Repeat steps 6 and 7 for a second wash. 9. Pulse-spin the tube, place it back in the magnetic rack, and remove any remaining residual ethanol with a 20-μL pipettor, without disturbing the pellet. 10. Keeping the tube on the magnet, air-dry the beads at room temperature for ~5 minutes. 11. Remove the tube from the magnetic rack, and add 52 μl of Elution Buffer directly to the pellet to disperse the beads. 12. Mix thoroughly by pipetting the suspension up and down 5 times. Do not vortex the tube. 13. Pulse-spin and place the tube in the magnetic rack for at least one minute until the solution clears. 14. Transfer 50 μl of the supernatant containing eluted DNA to a new 1.5 ml LoBind tube, without disturbing the pellet. 15. Determine the concentration using the Qubit dsdna BR Assay Kit with the Qubit 2.0 Fluorometer per the manufacturer's instructions. DNA concentration: ng/μl Note: The concentration will be used to calculate the input volume for coupler ligation. 16. Confirm the correct size selection by visualization with a 0.8% E-Gel, Agilent Bioanalyzer with the DNA 12000 Kit, or agarose gel. See Appendix C, DNA size selection vs. insert size, Panel C, for an example gel image. 26 Ion TrueMate Library Preparation

Chapter 5 Size-select DNA and ligate to coupler Ligate size-selected DNA to coupler 5 Ligate size-selected DNA to coupler 1. Determine volume of size-selected DNA required: a. Determine the concentration using the Qubit dsdna BR Assay Kit with the Qubit 2.0 Fluorometer per the manufacturer's instructions. DNA concentration: ng/µl Note: The concentration will be used to calculate the input volume for coupler ligation ("Z" below). b. Confirm the correct size selection by visualization with a 0.8% E-Gel, Agilent Bioanalyzer with the DNA 12000 Kit, or agarose gel. See Appendix C, DNA size selection vs. insert size, Panel C, for an example gel image. 2. Determine the amount of size-selected DNA required for the ligation reaction using the following equation: Calculated amount required: (Y) ng. 3. Determine the required volume of size-selected DNA required based on the concentration using the following equation: Note: "Z" is determined in step 1 above. Calculated volume required: (X) µl Ion TrueMate Library Preparation 27

5 Chapter 5 Size-select DNA and ligate to coupler Remove linear DNA 4. Add the following reagents in order to the tube containing the size-selected gdna: Reagent Size-selected gdna Volume X (calculated above) Coupler Mix (red cap) 3 µl 10X Ligase Buffer (blue cap) 40 µl Ligase (blue cap) 0.5 µl Nuclease-Free Water Up to 356.5 µl Total 400 µl Note: Use a 2-μL pipettor for Ligase addition. 5. Mix tube contents gently by pipetting up and down 10 times. 6. Place the tube in a thermomixer and incubate at 16 C overnight (14-16 hours). 7. Increase the temperature to 70 C and continue to incubate for 15 minutes to heat inactivate the DNA ligase. 8. Place the tube on ice for 2 minutes. 9. Pulse-spin to bring the contents to the bottom of the tube. Remove linear DNA 1. Add the following reagents in order to the tube containing the heat-inactivated coupler-ligated DNA: Reagent Volume Heat-inactivated coupled DNA 400 µl Nuclease I (black cap) 7 µl Nuclease II (black cap) 5 µl Total 412 µl 2. Mix gently by pipetting up and down 10 times. 3. Place the tube in a thermomixer or heat block and run the following program: Step Temperature Time 1 37 C 30 min 2 80 C 30 min 4. Place the tube on ice for 2 minutes and pulse-spin to bring the contents to the bottom of the tube. 28 Ion TrueMate Library Preparation

Chapter 5 Size-select DNA and ligate to coupler Bead clean-up 5 Bead clean-up 1. Add 412 μl of AMPure XP Beads to the tube containing the nuclease-treated DNA at room temperature: 2. Mix gently by pipetting up and down 10 times. 3. Incubate at room temperature for 5 minutes. 4. Place the tube in a magnetic rack and incubate for ~5 minutes, or until the supernatant becomes clear. 5. Carefully remove and discard the supernatant using a pipettor, without disturbing the pellet. 6. Wash the beads by adding 750 μl of freshly prepared 70% ethanol to the tube and incubate for 30 seconds, turning the tube around twice in the magnet to move the beads around. After the solution clears, remove and discard the supernatant without disturbing the pellet. 7. Repeat step 6 for a second wash. 8. Remove any remaining ethanol and let the bead pellet air dry for 5 minutes while still in the magnetic rack. 9. While still in the magnetic rack, add 37 μl of Elution Buffer (clear cap) to the tube. 10. Remove the tube from the magnetic rack and mix the beads and buffer by gently pipetting up and down 5 times. Do NOT vortex. 11. Incubate at room temperature for 5 minutes; do not keep the tube in the magnetic rack during the incubation. 12. Place the tube in a magnetic rack and incubate for ~5 minutes, or until the supernatant becomes clear. 13. Transfer 35 μl to a clean 1.5 ml LoBind tube. STOPPING POINT DNA may be stored at 4 C overnight. For longer periods, store at 20 C. Ion TrueMate Library Preparation 29

6 Restriction digest and purify target DNA Digest insert/coupler In this step, the cleaned insert/coupler is digested with a single enzyme or a mix of enzymes. The choice of enzyme(s) will determine the library size for sequencing. Test digests to determine optimal enzyme(s) were previously performed in Determine optimal restriction enzyme(s) for digestion on page 13. 1. Split the cleaned insert/coupler from the previous step into two 1.5 ml LoBind tubes. 2. To each tube, add the appropriate restriction enzyme(s) in the order indicated in the following table: Reagent Volume per reaction tube Cleaned insert/coupler 17 µl 10X Restriction Enzyme Buffer (white cap) or 2 µl CutSmart Buffer [1] Restriction enzyme(s) [2,3] 1 µl Total 20 µl [1] Use of 10X RE Buffer (supplied in Ion TrueMate RE Kit) or CutSmart Buffer (NEB) is highly recommended. Buffers from other vendors have not been tested and may not be compatible with the restriction enzyme(s) used to digest the gdna. [2] If using a pool of restriction enzymes, mix 10 units of each enzyme in a 1.5 ml LoBind tube and use 1 µl total for the digest. [3] If using enzymes other than those supplied in the Ion TrueMate RE Kit, use the manufacturer's recommended buffer. 3. Mix gently by pipetting up and down 10 times. 4. Place tubes in a thermomixer or heat block and incubate according to the instructions below. Step Temperature Time 1 37 C 30 min 2 80 C 15 min 5. Place tubes on ice for at least 2 minutes. 30 Ion TrueMate Library Preparation

Chapter 6 Restriction digest and purify target DNA Biotin-capture to remove unwanted DNA fragments 6 6. Pulse-spin the tube briefly to bring contents to the bottom of the tube. 7. Combine restriction digested material into one 1.5 ml LoBind tube and keep on ice until next steps. Biotin-capture to remove unwanted DNA fragments In this step, the target sequence (insert/coupler) will be captured and purified to remove competing fragments. Note: Prepare a master mix for multiple reactions, steps 1 9. Perform the following steps at room temperature: 1. Add 100 μl of Biotin Wash Buffer (yellow cap) to 40 μl of Dynabeads MyOne Streptavidin C1 beads in a clean 1.5 ml LoBind tube. 2. Mix gently by pipetting up and down 10 times. 3. Place the tube in a magnetic rack and incubate for ~5 minutes, or until the supernatant becomes clear. Remove the supernatant with a pipettor and discard. 4. Remove tube from magnetic rack. 5. Add 100 μl of Biotin Wash Buffer (yellow cap) and mix gently by pipetting up and down 10 times. 6. Place the tube in a magnetic rack and incubate for ~5 minutes, or until the supernatant becomes clear. Remove the supernatant with a pipettor and discard. 7. With tube in magnetic rack, add 10 μl of Biotin Wash Buffer (yellow cap). 8. Remove the tube from the magnetic rack and mix gently by pipetting up and down 5 times. Do NOT vortex. 9. Keep the washed Streptavidin beads on ice until ready to use, and prepare the clean-up reaction, below. 10. Add the following reagents in order to the tube containing the digested insert/ coupler: Reagent Volume Digested insert/coupler 40 µl Biotin Capture Buffer (yellow cap) 45 µl Nuclease-Free Water 3.5 µl Biotin Capture Reagent (yellow cap) 1.5 µl Total 90 µl Ion TrueMate Library Preparation 31

6 Chapter 6 Restriction digest and purify target DNA Biotin-capture to remove unwanted DNA fragments 11. Mix gently by pipetting up and down 10 times. Place the tube in a thermomixer or heat block and run the following program: Step Temperature Time 1 50 C 30 min 2 25 C 15 min 12. Pulse-spin to bring the contents to the bottom of the tube. 13. Add 10 μl of washed Streptavidin beads (prepared in step 9 above) to the tube. 14. Mix gently by pipetting up and down 10 times. 15. Place tube in a thermomixer or heat block and incubate at 25 C for 15 minutes; do not use a magetic rack. 16. Place tube in a magnetic rack and incubate for ~5 minutes, or until supernatant becomes clear. Remove supernatant with pipettor and discard. 17. Add 100 μl of Biotin Wash Buffer, remove the tube from the magnetic rack, and resuspend throughly by gently pipetting up and down 10 times. 18. Place tube in a magnetic rack and incubate for ~5 minutes, or until supernatant becomes clear. Remove supernatant with pipettor and discard. 19. Repeat steps 17 and 18 TWO more times, for a total of three washes. 20. While still in the magnetic rack, add 52 μl of the Biotin Elution Buffer (yellow cap) to the tube. 21. Remove tube from magnetic rack and mix the beads and buffer by gently pipetting up and down 5 times. Do NOT vortex. 22. Incubate in a 65 C thermomixer or heat block for 10 minutes. Do not use a magnetic rack during incubation. 23. Pulse-spin to bring the contents to the bottom of the tube. 24. Place tube in magnetic rack and incubate for ~5 minutes, or until supernatant becomes clear. 25. Transfer 50 μl of the supernatant to a new 1.5 ml LoBind tube. 32 Ion TrueMate Library Preparation

7 Ligate JunctionCode sequence and re-circularize DNA Ligate JunctionCode sequence to biotin-captured insert/coupler Note: Before you begin, bring the Tailing Buffer (orange cap) to room temperature. A precipitate will form upon thawing; vortex prior to use. 1. Add the following reagents in order to the biotin-captured insert/coupler: Reagent Volume Biotin-captured insert/coupler 50 µl Tailing buffer (orange cap) 50 µl Klenow Fragment(violet cap) 6 µl Total 106 µl 2. Mix gently by pipetting up and down 10 times. 3. Place the tube in a thermomixer or heat block and run the following program: Step Temperature Time 1 37 C 30 min 2 70 C 15 min 4. Place the tube on ice for 2 minutes and pulse-spin to bring the contents to the bottom of the tube. 5. Add the following reagents to the tube: Reagent Volume Biotin-captured DNA 106 µl JunctionCode sequence (white cap) 6 µl Ligase (blue cap) 8 µl Total 120 µl 6. Mix gently by pipetting up and down 10 times. Ion TrueMate Library Preparation 33

7 Chapter 7 Ligate JunctionCode sequence and re-circularize DNA Clean up JunctionCode -ligated DNA 7. Place the tube in a thermomixer or heat block and run the following program: Step Temperature Time 1 25 C 30 min 2 70 C 15 min 8. Place the tube on ice for 2 minutes and pulse-spin to bring the contents to the bottom of the tube. Clean up JunctionCode -ligated DNA 1. Add the following reagents in order to the tube containing the JunctionCode - ligated DNA at room temperature: Reagent Volume JunctionCode -ligated DNA 120 µl Elution Buffer (clear cap) 30 µl AMPure XP Beads 150 µl Total 300 µl 2. Mix gently by pipetting up and down 10 times. 3. Incubate the mixture at room temperature for 5 minutes. Do not keep the tube in the magnetic rack during incubation. 4. Pulse-spin to bring the contents to the bottom of the tube. Place in the magnetic rack for 5 minutes, or until the solution becomes clear. 5. Carefully remove and discard the supernatant with a pipettor without disturbing the bead pellet. 6. Without removing the tube from the magnet, add 750 μl of freshly prepared 70% ethanol. 7. Incubate for 30 seconds, turning the tube around twice in the magnet to move the beads around. After the solution clears, remove and discard the supernatant without disturbing the pellet. 8. Repeat steps 6 and 7 for a second wash. 9. Pulse-spin the tube, place it back in the magnetic rack, and remove any remaining residual ethanol with a 20-μL pipettor, without disturbing the pellet. 10. Keeping the tube on the magnet, air-dry the beads at room temperature for ~5 minutes. 11. Remove the tube from the magnetic rack, and add 52 μl of Elution Buffer directly to the pellet to disperse the beads. 34 Ion TrueMate Library Preparation

Chapter 7 Ligate JunctionCode sequence and re-circularize DNA Re-circularize DNA 7 12. Mix thoroughly by pipetting the suspension up and down 5 times. Do not vortex the tube. 13. Pulse-spin and place the tube in the magnetic rack for at least one minute until the solution clears. 14. Transfer 50 μl of the supernatant to a new 1.5 ml LoBind tube. STOPPING POINT DNA may be stored at 10 C overnight. For longer periods, store at 20 C. Re-circularize DNA 1. Add the following reagents in order to the tube containing the cleaned insert/ coupler: Reagent Volume Cleaned insert/coupler 50 µl Nuclease-Free Water 126 µl 10X Ligase Buffer (blue cap) 20 µl Ligase (blue cap) 2 µl T4 Polynucleotide Kinase (green cap) 2 µl Total 200 µl 2. Mix gently by pipetting up and down 10 times. 3. Place the tube in a thermomixer or heat block and run the following program: Step Temperature Time 1 25 C 45 min 2 70 C 15 min 4. Place the tube on ice for 2 minutes and pulse-spin to bring the contents to the bottom of the tube. Ion TrueMate Library Preparation 35

7 Chapter 7 Ligate JunctionCode sequence and re-circularize DNA Remove unwanted linear DNA Remove unwanted linear DNA In this step, the re-circularized insert/coupler is treated with exonuclease to remove linear DNA. 1. Add the following reagents in order to the tube containing the re-circularized insert/coupler: Reagent Volume Re-circularized insert/coupler 200.0 µl Nuclease I (black cap) 3.0 µl Nuclease II (black cap) 2.5 µl Total 205.5 µl 2. Mix gently by pipetting up and down 10 times. 3. Place the tube in a thermomixer or heat block and run the following program: Step Temperature Time 1 37 C 30 min 2 80 C 30 min 4. Place the tube on ice for 2 minutes then spin briefly to collect the droplets. Clean up exonuclease-treated insert/coupler 1. Add the following reagents in order to the tube containing the exonucleasetreated insert/coupler at room temperature: Reagent Volume Exonuclease-treated insert/coupler 205.5 µl AMPure XP Beads 205.5 µl Total 411.0 µl 2. Mix gently by pipetting up and down 10 times. 3. Incubate at room temperature for 5 minutes. 4. Place the tube in a magnetic rack and incubate for ~5 minutes, or until the supernatant becomes clear. 5. Carefully remove and discard the supernatant using a pipettor, without disturbing the pellet. 6. Wash the beads by adding 750 μl of freshly prepared 70% ethanol to the tube and incubate for 30 seconds, turning the tube around twice in the magnet to move the beads around. After the solution clears, remove and discard the supernatant without disturbing the pellet. 36 Ion TrueMate Library Preparation

Chapter 7 Ligate JunctionCode sequence and re-circularize DNA Clean up exonuclease-treated insert/coupler 7 7. Repeat step 6 for a second wash. 8. Remove any remaining ethanol and let the bead pellet air dry for 5 minutes while still in the magnetic rack. 9. While still in the magnetic rack, add 22 μl of Elution Buffer (clear cap) to the tube. 10. Remove the tube from the magnetic rack and mix the beads and buffer by gently pipetting up and down 5 times. Do NOT vortex. 11. Place the tube in a magnetic rack and incubate for ~5 minutes, or until the supernatant becomes clear. 12. Transfer 20 μl of the supernatant to a new 1.5 ml LoBind tube. STOPPING POINT DNA may be stored at 10 C overnight. For longer periods, store at 20 C. Ion TrueMate Library Preparation 37

8 Amplify DNA Identify optimal amplification conditions In this step, the exonuclease-treated insert/coupler is amplified. Prior to full amplification of library, it is recommended that you perform a test reaction to determine the optimal number of cycles to reduce the potential for overamplification. If you see inconsistent performance (i.e. over-amplification) using 2 μl of template and 20 cycles, additional test reactions may be necessary. See Appendix G, Additional test reactions for library amplification for more information. After determining the optimal template amount for amplification (using instructions below or in Appendix G, Additional test reactions for library amplification ) generate a fully amplified library for subsequent size selection and sequencing. 1. Prepare the PCR reaction according to the following table: Reagent Volume Accura Hot Start 2X Master Mix (brown cap) 10 µl Amplification primer mix (brown cap) 2 µl Nuclease-Free Water 6 µl Mate Pair Library DNA 2 µl Total 20 µl 2. Place the reaction tube in a thermocycler and run the following program: Stage Step Temperature Time Hold Cycle (20 cycles) Activate the enzyme 94 C 2 min Denature 94 C 15 sec Anneal 60 C 15 sec Extend 72 C 50 sec Hold Final extension 72 C 5 min 4 C Hold 38 Ion TrueMate Library Preparation

Chapter 8 Amplify DNA Identify optimal amplification conditions 8 3. To purify the amplified reactions, add the following reagents to each tube at room temperature: Reagent Volume Amplified reaction (from step 2) 20 µl Elution Buffer (clear cap) 30 µl AMPure XP Beads 90 µl Total 140 µl 4. Mix gently by pipetting up and down 10 times. 5. Incubate the mixture at room temperature for 5 minutes. Do not keep the tube in the magnetic rack during incubation. 6. Pulse-spin to bring the contents to the bottom of the tube. Place in the magnetic rack for 5 minutes, or until the solution becomes clear. 7. Carefully remove and discard the supernatant with a pipettor without disturbing the bead pellet. 8. Without removing the tube from the magnet, add 750 μl of freshly prepared 70% ethanol. 9. Incubate for 30 seconds, turning the tube around twice in the magnet to move the beads around. After the solution clears, remove and discard the supernatant without disturbing the pellet. 10. Repeat steps 8 and 9 for a second wash. 11. Pulse-spin the tube, place it back in the magnetic rack, and remove any remaining residual ethanol with a 20-μL pipettor, without disturbing the pellet. 12. Keeping the tube on the magnet, air-dry the beads at room temperature for ~5 minutes. 13. Remove the tube from the magnetic rack, and add 22 μl of Elution Buffer directly to the pellet to disperse the beads. 14. Mix thoroughly by pipetting the suspension up and down 5 times. Do not vortex the tube. 15. Pulse-spin and place the tube in the magnetic rack for at least one minute until the solution clears. 16. Transfer 20 μl of the supernatant to a new 1.5 ml LoBind tube. Ion TrueMate Library Preparation 39

8 Chapter 8 Amplify DNA Generate amplified library 17. Analyze 1 μl of the PCR product on a Bioanalyzer High Sensitivity Chip and compare to example traces below. Note: Ideal traces will show a peak in size distribution between 150 and 2000 bp. Product larger than 5 10 Kb could indicate over-amplification. See Appendix G, Additional test reactions for library amplification for additional information. Figure 5: Example traces of template titration (0.5, 1.0, and 2.0 μl) using 20 and 19 cycles. 18. Determine the concentration of the PCR product using a Bioanalyzer or Qubit 2.0 Fluorometer instrument and record below: Template amount 2 µl Concentration of PCR product Note: The minimum recommended concentration of amplified product is 0.3 ng/μl. See Appendix G, Additional test reactions for library amplification to run additional test reactions to determine optimal template amount. Generate amplified library 1. For each sample, set up the PCR reaction according to the following table. Prepare a master mix for multiple reactions. Note: We recommend setting up to 8 reactions when using 2 μl of template. Reagent Accura Hot Start 2X Master Mix (brown cap) Volume per reaction 10 µl Amplification primer mix (brown cap) 2 µl Mate-Pair Library DNA X µl Nuclease-Free Water 8 µl - X Total 20 µl # of reactions Master mix volume 2. Aliquot 20 μl of master mix into each 0.2 ml thermocycler tube. 40 Ion TrueMate Library Preparation

Chapter 8 Amplify DNA Generate amplified library 8 3. Place the reaction tubes in a thermocycler and run the following program: Stage Step Temperature Time Hold Cycle (20 cycles) Activate the enzyme 94 C 2 min Denature 94 C 15 sec Anneal 60 C 15 sec Extend 72 C 50 sec Hold Final extension 72 C 5 min 4 C Hold 4. Pool all amplified DNA into a single clean 1.5 ml LoBind tube. Ion TrueMate Library Preparation 41

9 Size select library Purify amplified library IMPORTANT! This step is only required if you intend to size select your library using Pippin Prep (recommended). If you will use AMPure beads as your size selection method, proceed to (Optional) Size select library using AMPure beads on page 44. 1. Add AMPure beads at 1.8X the volume of the pooled material at room temperature. 2. Mix gently by pipetting up and down 10 times. 3. Incubate the mixture at room temperature for 5 minutes. Do not keep the tube in the magnetic rack during incubation. 4. Pulse-spin to bring the contents to the bottom of the tube. Place in the magnetic rack for 5 minutes, or until the solution becomes clear. 5. Carefully remove and discard the supernatant with a pipettor without disturbing the bead pellet. 6. Without removing the tube from the magnet, add 750 μl of freshly prepared 70% ethanol. 7. Incubate for 30 seconds, turning the tube around twice in the magnet to move the beads around. After the solution clears, remove and discard the supernatant without disturbing the pellet. 8. Repeat steps 6 and 7 for a second wash. 9. Pulse-spin the tube, place it back in the magnetic rack, and remove any remaining residual ethanol with a 20-μL pipettor, without disturbing the pellet. 10. Keeping the tube on the magnet, air-dry the beads at room temperature for ~5 minutes. 11. Remove the tube from the magnetic rack, and add 52 μl of Elution Buffer directly to the pellet to disperse the beads. 12. Mix thoroughly by pipetting the suspension up and down 5 times. Do not vortex the tube. 42 Ion TrueMate Library Preparation

Chapter 9 Size select library (Recommended) Size select library using Pippin Prep 9 13. Pulse-spin and place the tube in the magnetic rack for at least one minute until the solution clears. 14. Transfer 20 μl of the supernatant to a new 1.5 ml LoBind tube. STOPPING POINT DNA may be stored at 10 C overnight. For longer periods, store at 20 C. (Recommended) Size select library using Pippin Prep Size select the mate-pair library for 480 bp according to the manufacturer's protocol. 1. From the cassette type drop-down menu, choose 1.5% DF Marker K. 2. Select the Tight collection mode for each lane and then define the BP Target setting for each lane as 480 bp. 3. Define lanes 1 5 as sample lanes and press the Use Internal Standards button to match the lane numbers and ensure that the "Ref Lane" values match the lane numbers. Purify mate-pair library 1. Add the following reagents in order to the tube containing the size-selected mate pair library at room temperature: Reagent Size-selected mate pair library AMPure XP Beads Volume X 1.8X sample volume 2. Mix gently by pipetting up and down 10 times. 3. Incubate the mixture at room temperature for 5 minutes. Do not keep the tube in the magnetic rack during incubation. 4. Pulse-spin to bring the contents to the bottom of the tube and place in the magnetic rack for 5 minutes, or until the solution becomes clear. 5. Carefully remove and discard the supernatant with a pipettor without disturbing the bead pellet. 6. Without removing the tube from the magnet, add 750 μl of freshly prepared 70% ethanol. 7. Incubate for 30 seconds, turning the tube around twice in the magnet to move the beads around. After the solution clears, remove and discard the supernatant without disturbing the pellet. 8. Repeat steps 6 and 7 for a second wash. 9. Pulse-spin the tube, place it back in the magnetic rack, and remove any remaining residual ethanol with a 20-μL pipettor, without disturbing the pellet. Ion TrueMate Library Preparation 43

9 Chapter 9 Size select library (Optional) Size select library using AMPure beads 10. Keeping the tube on the magnet, air-dry the beads at room temperature for ~5 minutes. 11. Remove the tube from the magnetic rack, and add 22 μl of Elution Buffer directly to the pellet to disperse the beads. 12. Mix thoroughly by pipetting the suspension up and down 5 times. Do not vortex the tube. 13. Pulse-spin and place the tube in the magnetic rack for at least one minute until the solution clears. 14. Transfer 30 μl of the supernatant to a new 1.5 ml LoBind tube. 15. Analyze 1 μl of library on a Bioanalyzer High Sensitivity Chip in triplicate. 16. Determine the concentration of the sample; see the requirements for OneTouch amplification in the table below: Library concentration Library volume 26 pm 25 µl STOPPING POINT DNA may be stored at 10 C overnight. For longer periods, store at 20 C. 17. Proceed with OneTouch and Ion Torrent sequencing. Note: Template preparation must be performed using Ion PGM Template OT2 400 Kit (Cat. no. 4479878). (Optional) Size select library using AMPure beads Perform a two-round purification with Agencourt AMPure XP Reagent: First round at 0.61X bead to sample volume ratio: High molecular-weight DNA is bound to beads, while the desired library and primers remain in solution. Save the supernatant. Second round at 0.65X bead to original sample volume ratio: the desired library is bound to beads, and primers remain in solution. Save the bead pellet, and elute the amplicons from the beads. IMPORTANT! Bring AMPure XP Reagent to room temperature and vortex thoroughly to disperse the beads before use. Pipet solution slowly. Do NOT substitute a Dynabeads -based purification reagent for the Agencourt AMPure XP Reagent. Use freshly prepared 70% ethanol for the next steps. 44 Ion TrueMate Library Preparation

Chapter 9 Size select library (Optional) Size select library using AMPure beads 9 First-round purification 1. Bring volume from the amplification step to 300 μl total volume with Low TE buffer. 2. Add 183 μl of Agencourt AMPure XP Reagent to each sample containing 300 μl of sample. 3. Pipet up and down 5 times to mix thoroughly. Incubate the mixture at room temperature for 5 minutes. Do not keep the tube in the magnetic rack during incubation. 4. Pulse-spin to bring the contents to the bottom of the tube and place in the magnetic rack for 5 minutes or until the solution becomes clear. 5. Carefully transfer the supernatant to a new 1.5 ml LoBind tube without disturbing the pellet. 6. Pulse-spin tube, place back in the magnetic rack, and remove any remaining residual supernatant with a 20-μL pipettor, without disturbing the pellet. Transfer the residual supernatant to the tube containing the supernatant (from step 5). IMPORTANT! The supernatant contains the desired library. Do not discard! Second-round purification 1. To the supernatant from step 5 above, add 12 μl of Agencourt AMPure XP Reagent. 2. Pipet up and down 10 times to thoroughly mix the bead suspension with the DNA. 3. Rotate the mixture on a rotator for 10 minutes at room temperature. 4. Pulse-spin to bring the contents to the bottom of the tube and place in the magnetic rack for 5 minutes, or until the solution becomes clear. IMPORTANT! The library is bound to the beads. Save the bead pellet. 5. Carefully remove and discard the supernatant with a pipettor without disturbing the bead pellet. 6. Without removing the tube from the magnet, add 750 μl of freshly prepared 70% ethanol. 7. Incubate for 30 seconds, turning the tube around twice in the magnet to move the beads around. After the solution clears, remove and discard the supernatant without disturbing the pellet. 8. Repeat steps 6 and 7 for a second wash. 9. Pulse-spin the tube, place it back in the magnetic rack, and remove any remaining residual ethanol with a 20-μL pipettor, without disturbing the pellet. Ion TrueMate Library Preparation 45

9 Chapter 9 Size select library (Optional) Size select library using AMPure beads 10. Keeping the tube on the magnet, air-dry the beads at room temperature for ~5 minutes. Note: Assess the dryness of the bead pellet by rotating the plate 90 in the magnet. The pellet should migrate slowly. Do not overdry. 11. Remove the tube from the magnetic rack, and add 22 μl of Elution Buffer directly to the pellet to disperse the beads. 12. Mix thoroughly by pipetting the suspension up and down 5 times. Do not vortex the tube. 13. Pulse-spin and place the tube in the magnetic rack for at least one minute until the solution clears. 14. Transfer 20 μl of the supernatant to a new 1.5 ml LoBind tube. 15. Analyze 1 μl of each PCR product on a Bioanalyzer High Sensitivity Chip and compare to example trace in Figure 1 below. The final library will have a wider range of fragments when using Agencourt AMPure XP Reagent. Ideal traces will show a peak in size distribution between 400 and 800 bp. Figure 6: Example trace of final size selected library using Agencourt AMPure XP Reagent. 16. Determine the concentration of library in the region from 100 500 bp. Library fragments longer than 500 bp will not template during OneTouch amplification 46 Ion TrueMate Library Preparation

Chapter 9 Size select library (Optional) Size select library using AMPure beads 9 17. Determine the concentration of the sample; see the requirements for OneTouch amplification in the table below: Library concentration Library volume 26 pm 25 µl STOPPING POINT DNA may be stored at 10 C overnight. For longer periods, store at 20 C. 18. Proceed with template preparation and Ion PGM sequencing. Note: Template preparation must be performed using Ion PGM Template OT2 400 Kit (Cat. no. 4479878). Note: When creating your planned run, set up a generic run with no Reference selected. If using the Ion PGM Calibration Standard, select Enable Calibration Standard in the Base Calibration Mode drop-down menu on the Kits page. Ion TrueMate Library Preparation 47

10 Sequence data analysis Ion PGM sequence data analysis The raw sequencing reads from the Ion PGM System contain a variety of ChimeraCode, Barcode, and JunctionCode sequence combinations. Prior to assembly, the raw reads must be filtered with scripts according to the following workflow. After this filtering, the data can be assembled using a number of open source or commercially available software. See Appendix E, Sequence analysis for details on the filtering process, scripts, and assembly software options. 48 Ion TrueMate Library Preparation

A Troubleshooting Observation Possible cause Recommended action RE digest does not generate 400 500 bp fragments Insufficient sample after shearing to proceed with endrepair reactions Wrong restriction enzymes selected Insufficient sample used prior to shearing. Poor performance of shearing method. Poor DNA quality Confirm activity of restriction enzymes used. Repeat restriction enzyme tests. Increase the amount of starting material. Optimize shearing method to reduce sample loss. If using an insert size of 5 Kb or above, use Covaris g-tubes. Confirm quality of starting material. Sample loss after size selection Incorrect bead amount used Repeat sample preparation starting with Chapter 3, Prepare adapter-compatible DNA. Sample does not match example trace after amplification Sample loss after Pippin Prep Sequence data analysis shows high percentage of duplicates Beads were not cold prior to addition to the cleaned insert with the ligated barcode Sheared sample too small Sample was over-amplified Sample was under-amplified Incorrect size selection with Pippin Prep Incorrect restriction enzyme selection Over-amplification (too many cycles and/or too little template used for each reaction) Use the amount of beads for the lowest range of your sheared material. Repeat sample preparation starting with Chapter 3, Prepare adapter-compatible DNA. Ensure AMPure beads are kept on ice prior to addition to barcoded DNA. Do not hold AMPure beads in your hand. Repeat sample preparation starting with Chapter 3, Prepare adapter-compatible DNA. Confirm that size of sheared gdna is correct prior to proceeding with protocol. Repeat library amplification, reducing the number of cycles used and/or decreasing the amount of template used for each PCR reaction. Repeat library amplification, increasing the number of cycles and/or increasing the amount of template used for each PCR reaction Optimize Pippin Prep target size. Confirm size of sample generated with the selected restriction enzymes. Size range should be ~ 200 1000 bp. Repeat library amplification, reducing the number of cycles used and/or decreasing the amount of template used for each PCR reaction. Ion TrueMate Library Preparation 49

A Appendix A Troubleshooting Observation Possible cause Recommended action Sequence data analysis shows low percentage of mates Poor coverage of genome; "hard stops" present High percentage of short reads from sequencing run Incorrect restriction enzymes used Ensure sequencer is functioning properly. The adapter, ChimeraCode and JunctionCode sequences require ~70 bp of each read. If the sequencing read is not long enough to read through the left ChimeraCode sequence the left mate pair, the JunctionCode sequence, the right mate-pair, and the right ChimeraCode sequence, the percentage of "mates" will decrease. Select and use the correct enzymes/ combinations of enzymes to obtain the best genome coverage See Appendix B, Restriction enzyme choice. 50 Ion TrueMate Library Preparation

B Restriction enzyme choice Mate-tag size depends on restriction enzyme choice The choice of restriction enzyme(s) will impact the final library in two ways: 1. Coverage of your genome 2. Amount of data that can be analyzed. If your DNA is digested into very small fragments, the combined size of mate-tag 1 and mate-tag 2 for the average sequence will be too small for size selection (Pippin Prep ) and will be lost. When your DNA is digested into large fragments, the combination of mate-tag 1 and mate-tag 2 will be too large for size selection or a significant percentage of your sequence will have one tag that is too short for analysis. The optimal restriction digest will have a peak size distribution at the same point as size selection for sequencing (400 bp insert, 480 bp library with Pippin Prep ). The panels below provide examples of the fragments lost based on size selection: Ion TrueMate Library Preparation 51

C DNA size selection vs. insert size DNA size selection vs. insert size When shearing DNA, it is important to create and size-select for fragments that are larger than the desired size range. Any given preparation of sheared DNA contains more fragments of smaller sizes (Panel A), which are cloned more efficiently than the larger fragments. Thus, the insert size of your final library will be skewed to the lower size range of your sheared DNA. Figure 7: Effect of size range of sheared DNA on insert size. (A), (A) The fragments of a given size in a sample of sheared DNA is shown (red curve). A library created from this preparation of sheared DNA is typically skewed toward the low end of the size range (green curve).(b), A narrower size range in sheared DNA and a resulting narrower differential in fragment size to insert size. For example, if a 5 Kb mate pair library is desired, sheared DNA should be size selected to approximately 6 Kb (A, broad size range) or approximately 7 Kb (B, narrow size range). (C, D), Analyses of two sequenced libraries E. coli gdna, (C), and Mus BAC DNA, (D), sheared with Megaruptor, (2 Kb and 5 Kb, respectively) where beads were used for size selection. The red bar indicates the average insert size +/- one SD (black bar). 52 Ion TrueMate Library Preparation

D Determining bead concentration Determining bead concentration for size selection The appropriate bead concentration is based on the lower end of the desired insert size range. For example, if your sheared material ranges in size from 2 4 Kb, the amount of beads used in Size-select barcoded DNA on page 25 should be 0.43X or 172 μl. Figure 8: Effect of bead concentration on DNA size selection. (A), Gel image of three different insert sizes. The lower end of the size distribution is highlighted with the red arrows and the recommended volume of beads to be used is provided. (B), comparison of the bead concentrations to the sample cut off. Ion TrueMate Library Preparation 53

E Sequence analysis Overview Sequence reads from the PGM will contain a variety of ChimeraCode sequences, barcodes, and JunctionCode sequence combinations. The workflow first splits the raw sequence file (fastq) into two files: "Mates" contain only true mates (reads with both matching chimera codes present) "Nonmates" contain everything else, which will include chimeras (mis-matched ChimeraCode sequences) and non-mate reads (lacking a second ChimeraCode sequence, possibly also lacking a JunctionCode sequence). The "mates" file must be split into simulated "Read1" and "Read2" files for use by assembly programs. Note: Contamination scanning should be performed after splitting the reads to avoid influence of ChimeraCode and JunctionCode sequences. Software requirements For mate-pair analysis, you may choose a free option or a paid option. The free option requires you download the SPAdes v3.1 assembly algorithm and obtain all the software versions and scripts listed in the table below. The paid option, SeqMan NGen, is available from DNASTAR and is a complete package that contains all the required scripts. Software [1] Python 2.6 or 2.7 ParseFastQ.py Regex module BioPython bam2fastq matepairingsplitreads.py SeqTK Available from http://www.python.org/downloads/ https://gist.github.com/xguse/1866279 https://pypi.python.org/pypi/regex http://biopython.org/wiki/download http://ioncommunity.lifetechnologies.com/docs/ DOC-9352 http://ioncommunity.lifetechnologies.com/docs/ DOC-9352 https://github.com/lh3/seqtk [1] Tested on Ubuntu 12.04 54 Ion TrueMate Library Preparation

Appendix E Sequence analysis Sequence analysis example E Sequence analysis example The data accessible from http://ioncommunity.lifetechnologies.com/docs/doc-9352 provides the users with Mate Pair and Fragment example data that can be used for assembly using SPAdes 3.1 or other software like DNASTAR's Lasergene Genomics Suite. The sample data directory contains the following 5 files: File name fragk12mg1655_orr-338- R190353_43623_IX001_750K.fastq mp_test.bam mp_test.split.summary.txt R_JS6_fwd_mp5kb_K12_BEL-842_Mega_5 00K.fastq R_JS6_rev_mp5kb_K12_BEL-842_Mega_50 0K.fastq Description This is a fragment data with 750,000 reads Mate-pair data in bam format. Summary results from splitting the mp_test.bam file Forward reads from mate-pair data Reverse reads from mate-pair data The script directory contains the following 3 files: File Name Description bam2fastq LICENSE_bam2fastq.txt matepairingsplitreads.py The bam2fastq file is a binary used for converting bam format to fastq format. License information. The matepairingsplitreads.py script is used for converting mate-pair data into forward and reverse reads. To execute the assembly: Type the following command into the command-line interface: python matepairingsplitreads.py -h Note: This script requires the regex python module. This module can be obtained from: https://pypi.python.org/pypi/regex. Python version 2.7 is recommended. Assembly software options De novo sequencing provides novel information for a target with an unknown sequence. However, sequencing without a reference poses challenges. Several analysis software options, listed in the table below, make de novo sequencing possible. Initial assemblies can be done with any of these software options, and then further refined with DNAStar's Lasergene Genomics Suite. Ion TrueMate Library Preparation 55

E Appendix E Sequence analysis Assembly software options For users who wish to have their genomes assembled professionally, in-house assembly services are also available. For more information on the analysis of de novo sequencing using mate pairs and sample data with scripts, please visit https:// www.lifetechnologies.com/us/en/home/life-science/sequencing/dna-sequencing/ microbial-sequencing/microbial-identification-ion-torrent-next-generationsequencing/de-novo-microbial.html. Open source Ray Allpaths-LG Velvet SPAdes v3.1 Commercially available www.dnastar.com CLC Genomics Workbench NextSeq bioinf.spbau.ru/spades 56 Ion TrueMate Library Preparation

F Sequence and location information Barcode adapters and JunctionCode Sequence Feature Barcode A (End-repair kit) JunctionCode Sequence Sequence TAAGGAGAAC GGTTCATCGTCAGGCCTGAC ChimeraCode Sequences ChimeraCode # Sequence ChimeraCode # Sequence 1 TGGACT 2 TCTGGA 3 ACTTCG 4 TGATGT 5 TGAGTC 6 TCGTGA 7 TGACTG 8 GTGCTA 9 TCAGGT 10 GAGGTT 11 ATGTCA 12 AGTTGT 13 GTATGA 14 TTAGAC 15 GTCTAC 16 CGTGTA Ion TrueMate Library Preparation 57

F Appendix F Sequence and location information ChimeraCode Sequences ChimeraCode # Sequence ChimeraCode # Sequence 17 GTTGGA 18 GTTCTC 19 CGATTC 20 AATCTC 21 GGTTAC 22 TAGGTC 23 TCACCT 24 GAGTCT 58 Ion TrueMate Library Preparation

G Additional test reactions for library amplification Additional test reactions for library amplification If you observe inconsistent performance (i.e. over-amplification) using 2 μl of template and 20 cycles, additional test reactions may be necessary. The instructions in this appendix provide information for testing three template amounts using 20 cycles. 1. Prepare three PCR reactions according to the following table: Reagent PCR 1 PCR 2 PCR 3 Accura Hot Start 2X Master Mix (brown cap) 10 µl 10 µl 10 µl Amplification primer mix (brown cap) 2 µl 2 µl 2 µl Nuclease-Free Water 7.5 µl 7 µl 6 µl Mate Pair Library DNA 0.5 µl 1.0 µl 2.0 µl Total 20 µl 20 µl 20 µl 2. Place the three reaction tubes in a thermocycler and run the following program: Stage Step Temperature Time Hold Cycle (20 cycles) Activate the enzyme 94 C 2 min Denature 94 C 15 sec Anneal 60 C 15 sec Extend 72 C 50 sec Hold Final extension 72 C 5 min 4 C Hold Ion TrueMate Library Preparation 59

G Appendix G Additional test reactions for library amplification Additional test reactions for library amplification 3. Purify the PCR products and add the following reagents to each tube at room temperature: Reagent Volume PCR products (from step 2) 20 µl Elution Buffer 30 µl AMPure XP Beads 90 µl Total 140 µl 4. Mix gently by pipetting up and down 10 times. 5. Incubate the mixture at room temperature for 5 minutes. Do not keep the tube in the magnetic rack during incubation. 6. Pulse-spin to bring the contents to the bottom of the tube. Place in the magnetic rack for 5 minutes, or until the solution becomes clear. 7. Carefully remove and discard the supernatant with a pipettor without disturbing the bead pellet. 8. Without removing the tube from the magnet, add 750 μl of freshly prepared 70% ethanol. 9. Incubate for 30 seconds, turning the tube around twice in the magnet to move the beads around. After the solution clears, remove and discard the supernatant without disturbing the pellet. 10. Repeat steps 8 and 9 for a second wash. 11. Pulse-spin the tube, place it back in the magnetic rack, and remove any remaining residual ethanol with a 20-μL pipettor, without disturbing the pellet. 12. Keeping the tube on the magnet, air-dry the beads at room temperature for ~5 minutes. 13. Remove the tube from the magnetic rack, and add 22 μl of Elution Buffer directly to the pellet to disperse the beads. 14. Mix thoroughly by pipetting the suspension up and down 5 times. Do not vortex the tube. 15. Pulse-spin and place the tube in the magnetic rack for at least one minute until the solution clears. 16. Transfer 20 μl of the supernatant to a new 1.5 ml LoBind tube. 60 Ion TrueMate Library Preparation

Appendix G Additional test reactions for library amplification Additional test reactions for library amplification G 17. Analyze 1 μl of each PCR product on a Bioanalyzer High Sensitivity Chip and compare to example traces below (Figure 5). Ideal traces will show a peak in size distribution between 150 and 2000 bp. Product larger than 5 10 Kb could indicate over amplification. Figure 9: Example traces of template titration (0.5, 1.0, and 2.0 µl) using 20 and 19 cycles. 18. Determine the concentration of the PCR product using Bioanalyzer or Qubit 2.0 Fluorometer and record below: Template amount Concentration of PCR product 0.5 µl 1.0 µl 2.0 µl Note: The minimum recommended concentration of amplified product is 0.3 ng/μl. Use the graph below (Figure 6) to identify the minimum number of cycles required to exceed this threshold while avoiding excess final amplified product. Figure 10: Total amount of library after combination of 8 PCR reactions. The Y- axis represents the concentration of the amplified product (ng/μl) and the value at the top of each green bar indicates the estimated total amount of product that would be achieved after using the specified amount of template and cycle Ion TrueMate Library Preparation 61

G Appendix G Additional test reactions for library amplification Additional test reactions for library amplification number. Reducing the cycle number will reduce amplicon redundancy and still yield sufficient library for size selection. 62 Ion TrueMate Library Preparation

Safety WARNING! GENERAL SAFETY. Using this product in a manner not specified in the user documentation may result in personal injury or damage to the instrument or device. Ensure that anyone using this product has received instructions in general safety practices for laboratories and the safety information provided in this document. Before using an instrument or device, read and understand the safety information provided in the user documentation provided by the manufacturer of the instrument or device. Before handling chemicals, read and understand all applicable Safety Data Sheets (SDSs) and use appropriate personal protective equipment (gloves, gowns, eye protection, etc). To obtain SDSs, see the Documentation and Support section in this document. Ion TrueMate Library Preparation 63

Safety Chemical safety Chemical safety WARNING! GENERAL CHEMICAL HANDLING. To minimize hazards, ensure laboratory personnel read and practice the general safety guidelines for chemical usage, storage, and waste provided below, and consult the relevant SDS for specific precautions and instructions: Read and understand the Safety Data Sheets (SDSs) provided by the chemical manufacturer before you store, handle, or work with any chemicals or hazardous materials. To obtain SDSs, see the Documentation and Support section in this document. Minimize contact with chemicals. Wear appropriate personal protective equipment when handling chemicals (for example, safety glasses, gloves, or protective clothing). Minimize the inhalation of chemicals. Do not leave chemical containers open. Use only with adequate ventilation (for example, fume hood). Check regularly for chemical leaks or spills. If a leak or spill occurs, follow the manufacturer's cleanup procedures as recommended in the SDS. Handle chemical wastes in a fume hood. Ensure use of primary and secondary waste containers. (A primary waste container holds the immediate waste. A secondary container contains spills or leaks from the primary container. Both containers must be compatible with the waste material and meet federal, state, and local requirements for container storage.) After emptying a waste container, seal it with the cap provided. Characterize (by analysis if necessary) the waste generated by the particular applications, reagents, and substrates used in your laboratory. Ensure that the waste is stored, transferred, transported, and disposed of according to all local, state/provincial, and/or national regulations. IMPORTANT! Radioactive or biohazardous materials may require special handling, and disposal limitations may apply. 64 Ion TrueMate Library Preparation

Safety Biological hazard safety Biological hazard safety WARNING! BIOHAZARD. Biological samples such as tissues, body fluids, infectious agents, and blood of humans and other animals have the potential to transmit infectious diseases. All work should be conducted in properly equipped facilities using the appropriate safety equipment (for example, physical containment devices). Safety equipment also may include items for personal protection, such as gloves, coats, gowns, shoe covers, boots, respirators, face shields, safety glasses, or goggles. Individuals should be trained according to applicable regulatory and company/ institution requirements before working with potentially biohazardous materials. Follow all applicable local, state/provincial, and/or national regulations. The following references provide general guidelines when handling biological samples in laboratory environment. U.S. Department of Health and Human Services, Biosafety in Microbiological and Biomedical Laboratories (BMBL), 5th Edition, HHS Publication No. (CDC) 21-1112, Revised December 2009; found at: www.cdc.gov/biosafety/publications/bmbl5/bmbl.pdf World Health Organization, Laboratory Biosafety Manual, 3rd Edition, WHO/CDS/CSR/LYO/2004.11; found at: www.who.int/csr/resources/publications/biosafety/biosafety7.pdf Ion TrueMate Library Preparation 65